| top of page |
| Type and details of transgene |
| Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
| Transgene name | Firefly luciferase |
| top of page |
| Details of the genetic modification |
| Inducable system used | No |
| Additional remarks inducable system |
|
| Type of plasmid/construct | Plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | tgdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | No details are provided on the generation of the DNA construct used for transfection. Reference is made to the paper Spencer et al. (Nature protocols 2011; 6(4): 553). In this paper the follwing information is provided: To generate a vector that introduces transgenes into the P.c. chabaudi SSu-rRNA locus on chromosomes 5, the Pl0017 plasmid vector (Franke-Fayard, B. et al. 2004; Mol. Biochem. Parasitol. 137, 23–33) was modified as follows: (i) A KpnI-ApaI fragment of the P. berghei SSu-rRNA target region of pL0017 was excised and replaced with the corresponding 704-bp region of P.c. chabaudi chromosome 5 SSu-rRNA that was amplified from Pcc AS genomic DNA using the primers; GACTGGTACCAGTAGTCATATGCTTGTCTC and CAATGGGCCCTATAGTTAAAAGTACGACGAGGC (restriction sites underlined); (ii) The BamH1-Not1 fragment of PF0017 encoding green fluorescent protein was excised and replaced with the transgene. |
| Additional remarks selection procedure | |
| top of page |
| Other details transgene |
| top of page |
| Promoter |
| Gene Model of Parasite |
PBANKA_1133300
|
| Gene Model P. falciparum ortholog |
PF3D7_1357100
|
| Gene product | elongation factor 1-alpha |
| Gene product: Alternative name | eef1a |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| top of page |
| 3'-UTR |
| Gene Model of Parasite |
PBANKA_0719300
|
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative |
| Gene product: Alternative name | dhfr/ts |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| Insertion/Replacement locus |
| Replacement / Insertion | Insertion locus |
| Gene Model of Parasite |
Not available
|
| Gene product | Not available |
| Gene product: Alternative name | small subunit (ssu) ribosomal RNA locus |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
|
|
| top of page |