SummaryRMgm-932
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 24509910 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | T. Annoura; S.M. Khan; C.J. Janse |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-932 |
Principal name | 1309cl1 |
Alternative name | Δb9-a |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Normal sporozoite production. Sporozoites showed normal gliding motility and WT-levels of hepatocyte invasion. When Swiss or BALB/c mice were infected by intravenous inoculation of either 1 or 5x104 PbΔb9 sporozoites none of the mice developed blood-stage infections. When C57BL6 mice were infected with a high dose of 5x104 PbΔb9 sporozoites, 10-20% developed a blood-stage infection with a 3-4 days prolonged prepatent period. Immunofluorescence analyses show that PbΔb9 parasites arrest early after invasion of hepatocytes. PbΔb9 sporozoites exhibit normal hepatocyte invasion, but at 24hpi most intra-cellular parasites had disappeared and only a few small parasites could be observed with a size that was similar to 5-10 hpi liver stages. Analysis of PbΔb9 parasites in the liver, using real-time in vivo imaging, confirmed the early growth-arrest observed in cultured hepatocytes. |
Additional remarks phenotype | Mutant/mutation Supporting Figure S5 Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0808100 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0317100 | ||||||||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||||||||
Gene product: Alternative name | B9 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |