RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-912
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0501100; Gene model (P.falciparum): Not available; Gene product: small exported protein early transcribed membrane protein (SEP3; ETRAMP; Pbsep3)
Name tag: mCherry
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 11 July 2013, 09:32
  *RMgm-912
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23840634
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone clone 8417HP
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherCurrà, C.; Pace, T.; Ponzi, M.
Name Group/DepartmentDipartimento di Malattie Infettive, Parassitarie ed Immunomediate
Name InstituteIstituto Superiore di Sanita
CityRome
CountryItaly
Name of the mutant parasite
RMgm numberRMgm-912
Principal namePbsep3- mcherry
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stagePbsep3- mcherry expression in blood stages
Gametocyte/GametePbsep3- mcherry expression in gametocytes
Fertilization and ookinetePbsep3- mcherry expression in ookinetes
Oocyst(Weak)Pbsep3- mcherry expression in oocysts.
Young oocysts (8 days) displayed only a very faint signal confined to a small pigmented area, most probably corresponding to a residual ookinete-derived compartment. In mature oocysts (12 days) and in salivary gland sporozoites only a diffuse very weak fluorescence was detected.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal mCherry tagged version of SEP3. The tagged version is integrated into the c/d-ssurRNA gene locus.

Protein (function)
Early transcribed membrane protein (ETRAMP) family member. Plasmodium conserved family with greater than ten members in P. falciparum. ETRAMPs are abundantly expressed early in the intraerythrocytic cycle and are small (frequently less than 200 aa) integral membrane proteins that are localized within the parasitophorous vacuolar membrane (PVM). All members have signal peptides plus a transmembrane domain. The ETRAMP/SEP proteins of P. yoelii and P. berghei (8-11 genes) show homology to members of the ETRAMP family of proteins of P. falciparum (14 genes) but the orthologous relationship of the different members is not completely resolved.

P. berghei sep genes, Pbsep1, Pbsep2 and Pbsep3 (PBANKA_052480, PBANKA_052420 and PBANKA_050110, respectively) are 3 ETRAMP members which reside in the subtelomeric regions of chromosome 5. The three genes share the upstream regulatory region and differ in their 3’UTRs. The encoded proteins (13-16 KDa) are nearly identical in the first 81 amino acids, which include a predicted signal peptide, a lysine-rich domain and a TM region, while differ in their C-terminal portion.
Mutants lacking expression of SEP1 have been generated (RMgm-16, RMgm-18) which show a normal phenotype during the complete life cycle, comparable to wild type parasites.
Multiple unsuccessful attempts to disrupt sep2 en sep3 (RMgm-64, RMgm-65) indicate that these proteins are essential for blood stage proliferation.

In asexual blood stages SEP2 and SEP3 localize to the PVM and to vesicle-like structures exported to the erythrocyte cytosol (RMgm-680, RMgm-681), while SEP1 is mainly confined to the PVM.

Phenotype:
SEP3 is expressed in all asexual blood stages, gametocytes, ookinetes and oocysts Evidence is provided for a PVM location in blood stages.
Young oocysts (8 days) displayed only a very faint signal confined to a small pigmented area, most probably corresponding to a residual ookinete-derived compartment. In mature oocysts (12 days) and in salivary gland sporozoites only a diffuse very weak fluorescence was detected.

Additional information
In order to establish whether the downstream regulatory regions have a role in the control of sep2 and sep3 expression level of these genes,  A. stephensi mosquitoes were infected with two transgenic lines, gfp-3'utr-sep2 and gfp-3'utrsep3, containing a stably integrated gfp reporter under the control of the 1.2-kb upstream regulatory region common to sep genes and the 3'UTR specific for either sep2 or sep3. In asexual blood stages these transgenic lines express GFP at a comparable level, indicating that the specific 3'UTRs have no significant regulatory role. In the gfp-3'utr-sep2 line, GFP fluorescence was clearly detected during oocyst maturation (8, 11, 13 days after the blood meal) with an increased intensity in mature oocysts (13 days). A strong GFP-specific signal was also detected in salivary gland sporozoites (22 days). When the GFP was expressed under the control of the 3'-UTR specific for sep3 (gfp-3'utr-sep3 line), only mature oocysts and salivary gland sporozoites displayed a faint fluorescence. These results show that the 3'UTRs of sep2 and sep3 modulate the expression level of GFP.

Other mutants
Mutants lacking expression of SEP1  (RMgm-16, RMgm-18)
Multiple unsuccessful attempts to disrupt sep2 en sep3 (RMgm-64, RMgm-65)
Mutants expressing a flag-tagged version of SEP2 and SEP3 (RMgm-680, RMgm-681)
A mutant expressing an mCherry-tagged version of SEP2 (RMgm-911)


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0501100
Gene Model P. falciparum ortholog Not available
Gene productsmall exported protein early transcribed membrane protein
Gene product: Alternative nameSEP3; ETRAMP; Pbsep3
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant expresses a C-terminal mCherry tagged version of SEP3. The tagged version is integrated into the c/d-ssurRNA gene locus.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1gaccactagtgacgtcGTAGATTCTGGTGGATATTATC
Additional information primer 1Sep3 3’UTR: 3’-ter-spe
Sequence Primer 2Gaccgcggccgccaatttaccataatcaaacag
Additional information primer 2Sep3 3’UTR: 3’-ter-not
Sequence Primer 3GaccctcgagCTAGTAATGGCAATAAATTGC
Additional information primer 3Sep3 5’UTR: 1&ter-prom-s
Sequence Primer 4Gaccaagctttttcgtataattaagtaaaaaaa
Additional information primer 4Sep3 5’UTR: Ter-prom-Hind-rev
Sequence Primer 5gaccgaattcaagcttATGAAATTAGCAAAAGCATT
Additional information primer 5Sep3 coding:SepterHind-cod-for
Sequence Primer 6gacccccgggcaaataacgtaattgatagcg
Additional information primer 6Sep3 coding: septerSma-cod-rev