RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-909
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0822300; Gene model (P.falciparum): PF3D7_0921400; Gene product: NifU-like scaffold protein (NifU; NFUapi)
Transgene
 Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_1340000; Gene product: dihydrofolate synthase/folylpolyglutamate synthase, putative (PbDHFS-FPGS)
Replacement locus: Gene model: PBANKA_0822300; Gene product: NifU-like scaffold protein (NifU; NFUapi)
Phenotype Liver stage;
Last modified: 28 June 2013, 22:31
  *RMgm-909
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23805304
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherJ.M. Haussig, K. Matuschewski, T.W.A. Kooij
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
top of page
Name of the mutant parasite
RMgm numberRMgm-909
Principal namenfu–
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNumbers of nfu– liver stage parasites in cultured hepatocytes were similar to those of WT parasites. Quantification of nfu- merosomes, merozoite-filled vesicles budding from mature liver stage parasites, showed a reduction 60% as compared to WT parasites.
Prepatency was tested by either intravenous injection of 100 or 10,000 sporozoites or by exposure to bites of 5–7 infected Anopheles stephensi mosquitoes. Irrespective of the mode of sporozoite delivery, initiation of blood infection was comparable between nfu– and WT-infected animals.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of NFUapi and expresses GFP under the control of the constitutive and strong hsp70 promoter. The construct to delete the nfuapi gene contains a GFP expression cassette. In this cassette the gfp gene is under the control of the hsp70 promoter (see for more information on the basic plasmid pBAT-SIL6 the mutant RMgm-757)

Protein (function)
Iron-sulfur [Fe-S] clusters are inorganic cofactors that constitute one of the most ancient and ubiquitous prosthetic groups. Proteins containing [Fe-S] clusters have diverse functions. In eukaryotes, different biogenesis machineries have been identified that assemble [Fe-S] clusters in various cellular compartments, namely the cytoplasmic iron-sulfur protein assembly (CIA), the mitochondrial ironsulfur cluster (ISC), and the plastid-localized sulfur utilization factor (SUF).
Plasmodium species harbor genes that could be involved in all three [Fe-S] cluster biosynthetic pathways found in eukaryotes. Malaria parasites are equipped with components of the SUF system, which are predicted to target to the vestigial plastid. [Fe-S] cluster-containing proteins in the apicoplast are central to several biosynthesis pathways, including mevalonate independent isoprenoid biosynthesis, lipoic acid metabolism, and biogenesis of [Fe-S] clusters itself.
NFUapi is a NifUlike domain containing protein (NFU) in the [Fe-S] biosynthesis pathway of the Plasmodium. Malaria parasite genomes encode three NifU-like domain containing proteins, related to the bacterial NIF system. Two of these were predicted to target to the mitochondrion, one ISU/IscU ortholog (PBANKA_131820) and one NFU1/NfuA ortholog (PBANKA_083170). The third protein, that was termed NFUapi, is expected to localize to the apicoplast (PBANKA_082230).

Phenotype
Phenotype analyses indicate that NFUapi has no essential role throughout the complete life cycle. Only the final maturation of liver stgae development was 'slightly' affected. Numbers of nfu– liver stage parasites in cultured hepatocytes were similar to those of WT parasites. Quantification of nfu- merosomes, merozoite-filled vesicles budding from mature liver stage parasites, showed a reduction 60% as compared to WT parasites.
Prepatency was tested by either intravenous injection of 100 or 10,000 sporozoites or by exposure to bites of 5–7 infected Anopheles stephensi mosquitoes. Irrespective of the mode of sporozoite delivery, initiation of blood infection was comparable between nfu– and WT-infected animals.

Additional information
Phenotype analyses of liver stages of a mutant expressing a C-terminal mCherry-3xMyc tagged version of NFUapi provide evidence for a localisation in the apicoplast (see RMgm-910).

Other mutants
A mutant expressing a C-terminal mCherry-3xMyc tagged version of NFUapi (see RMgm-910).

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0822300
Gene Model P. falciparum ortholog PF3D7_0921400
Gene productNifU-like scaffold protein
Gene product: Alternative nameNifU; NFUapi
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct to delete the nfuapi gene contains a GFP expression cassette. In this cassette the gfp gene is under the control of the hsp70 promoter (see for more information on the basic plasmid pBAT-SIL6 the mutant RMgm-757).

For targeted gene deletion of the P. berghei NFUapi gene, fragments of the 5'UTR and of the 3'UTR were amplified from gDNA using gene-specific primers (see below). PCR fragments were cloned into the berghei adaptable transfection vector (pBAT-SIL6), which contains drug-selectable and high-expressing GFP cassettes. First, the 3'UTR homologous sequences were cloned following restriction digestion of vector and insert with HindIII and KpnI. Then, the 5'UTR homologous sequences digested with SacII and EcoRV were cloned into SacII and PvuII linearized vector, thus removing the mCherry-3xMyc tag from the original vector. The resulting plasmids were linearized with SalI and used to transfect P. berghei strain ANKA (WT) parasites.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TATCCGCGGTTTTTCCTATAAATGTGTGTGTAATGC
Additional information primer 1TV-5'NFU-F
Sequence Primer 2AAAGATATCACTCACAAAAATAAGCACATGATTG
Additional information primer 2TV-5'NFU-R
Sequence Primer 3TATAAGCTTCAGCGGCTAGTCAATCTAATC
Additional information primer 3TV-3'NFU-F
Sequence Primer 4TAAGGTACCGTTCATTTAAAACACCAGCGAG
Additional information primer 4TV-3'NFU-R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe construct to delete the nfuapi gene contains a GFP expression cassette. In this cassette the gfp gene is under the control of the hsp70 promoter (see for more information on the basic plasmid pBAT-SIL6 the mutant RMgm-757).

For targeted gene deletion of the P. berghei NFUapi gene, fragments of the 5'UTR and of the 3'UTR were amplified from gDNA using gene-specific primers (see below). PCR fragments were cloned into the berghei adaptable transfection vector (pBAT-SIL6), which contains drug-selectable and high-expressing GFP cassettes. First, the 3'UTR homologous sequences were cloned following restriction digestion of vector and insert with HindIII and KpnI. Then, the 5'UTR homologous sequences digested with SacII and EcoRV were cloned into SacII and PvuII linearized vector, thus removing the mCherry-3xMyc tag from the original vector. The resulting plasmids were linearized with SalI and used to transfect P. berghei strain ANKA (WT) parasites.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_1340000
Gene productdihydrofolate synthase/folylpolyglutamate synthase, putative
Gene product: Alternative namePbDHFS-FPGS
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0822300
Gene productNifU-like scaffold protein
Gene product: Alternative nameNifU; NFUapi
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren