SummaryRMgm-908
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23773015 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 2.34 |
Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | A. Tremp, J.T. Dessens |
Name Group/Department | Department of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases |
Name Institute | London 11 School of Hygiene & Tropical Medicine |
City | London |
Country | UK |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-908 |
Principal name | G2::GFP |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Very weak cytoplasmic GFP based fluorescence in female gametocytes. |
Fertilization and ookinete | Very weak cytoplasmic GFP based fluorescence in female gametocytes. Fluorescence levels increased concomitant with ookinete development culminating in mature ookinetes with strong GFP signal concentrated both at the periphery of the cell and in an apically located cap-like structure with a pore in the centre. Retorts (i.e. developing, immature ookinetes) displayed cortical fluorescence only in the ‘ookinete’ portion that protrudes from the spherical zygote, indicating that G2 associates with the pellicle structure and not the plasma membrane. |
Oocyst | Very weak cytoplasmic GFP based fluorescence in female gametocytes. Fluorescence levels increased concomitant with ookinete development culminating in mature ookinetes with strong GFP signal concentrated both at the periphery of the cell and in an apically located cap-like structure with a pore in the centre. In young oocysts at four days after infecting mosquitoes, GFP fluorescence had largely disappeared, except for the apical cap structure, and at six days post-infection the majority of oocysts lacked any discernible fluorescence. GFP-based fluorescence was again observed in oocysts from around 8-10 days after infecting mosquitoes, reaching peak levels during sporulation. The G2::GFP fusion protein concentrated at the periphery of the sporozoites, but in contrast to ookinetes was found associated with neither anterior nor posterior end. This is consistent with the observation that Plasmodium sporozoites, contrary to ookinetes, do not possess a cap-like structure. |
Sporozoite | In young oocysts at four days after infecting mosquitoes, GFP fluorescence had largely disappeared, except for the apical cap structure, and at six days post-infection the majority of oocysts lacked any discernible fluorescence. GFP-based fluorescence was again observed in oocysts from around 8-10 days after infecting mosquitoes, reaching peak levels during sporulation. The G2::GFP fusion protein concentrated at the periphery of the sporozoites, but in contrast to ookinetes was found associated with neither anterior nor posterior end. This is consistent with the observation that Plasmodium sporozoites, contrary to ookinetes, do not possess a cap-like structure. |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation Phenotype analyses of a mutant lacking expression of G2 (RMgm-907) indicate a role of G2 in morphology and motility of ookinetes and sporozoites, resulting in a loss of infectivity of both ookinetes (reduced oocyst formation) and sporozoites (no invasion of salivary glands). G2::GFP parasites developed normally in mice and mosquitoes and were readily transmitted by infected mosquito bites, demonstrating that the GFP fusion to the G2 protein did not adversely affect parasite development. Examination of blood-stage parasites revealed very weak cytoplasmic GFP based fluorescence in female gametocytes. Fluorescence levels increased concomitant with ookinete development culminating in mature ookinetes with strong GFP signal concentrated both at the periphery of the cell and in an apically located cap-like structure with a pore in the centre. Retorts (i.e. developing, immature ookinetes) displayed cortical fluorescence only in the ‘ookinete’ portion that protrudes from the spherical zygote, indicating that G2 associates with the pellicle structure and not the plasma membrane. |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0830400 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0929600 | ||||||||||||||||||||||||||
Gene product | G2 protein, putative | ||||||||||||||||||||||||||
Gene product: Alternative name | G2 | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | EGFP | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | |||||||||||||||||||||||||||
Type of plasmid/construct | Plasmid double cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | The coding sequence of g2 plus approximately 0.6 kb of the 5′UTR were PCR amplified with primers pDNR-G2-F (ACGAAGTTATCAGTCGACGGTACCATTTTTGGCTAGATTTTATGACTTA) and pDNR-G2-R (ATGAGGGCCCCTAAGCTTATACATAATGAATATTCTTTTTTTTGCC) and introduced into SalI/HindIII-digested pDNR-EGFP via In-Fusion cloning to give plasmid pDNR-G2/EGFP. An approximately 0.7 kb sequence corresponding to the 3′UTR of g2 was PCR amplified with primers pLP-G2-F (TAAACCATTGGTCATAATGTGATGTCTTTCATATGATTCTC) and pLP-G2-R (CGGCCGCTCTAGCATGAAAAGCATATGATGTTATGAAGATG) and introduced into NdeI478 digested pLP-hDHFR2 via In-Fusion cloning to give plasmid pLP-DHFR/G2. The g2-specific sequence from pDNR-G2/EGFP was introduced into pLP-DHFR/G2 via Cre-loxP site-specific recombination to give the final transfection construct pLP-G2/EGFP, used to introduce a GFP-tagged version of g2 into its locus. Plasmid pDNR-G2/EFGP served as a template for PCR using primers deltaG2-F (ATTGAAAAAAGCTTAGGGGCCCTCAT) and deltaG2-R (CTAAGCTTTTTTCAATTTCTTCAGACTTTGATATATTT). The amplified plasmid DNA was recircularised via In-Fusion cloning, resulting in the transfection construct pDNR-ΔG2/EGFP, in which all but the first 13 amino acids of the g2 coding sequence have been removed. The g2-specific sequence from pDNR-ΔG2/EGFP was introduced into pLP-DHFR/G2 via Cre-loxP site-specific recombination to give the final transfection construct pLP-ΔG2/EGFP. This plasmid was used to introduce a GFP reporter gene into the g2 locus. | ||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |