RMgmDB - Rodent Malaria genetically modified Parasites
Back to search resultsSummaryRMgm-882
|
||||||||||
Last modified: 8 June 2014, 12:30
*RMgm-882| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190) |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | B. Franke-Fayard; J.B. Dame; C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1222500 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0808200 | ||||||||||||||||||||||||
| Gene product | plasmepsin X | ||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
ATGAAGAGCATAAAAATATTACCCGTATTTTATTTGGTGACATTTTTTTTGCACAACTAT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Unknown | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The negative attempts to disrupt plasmepsin X indicates an essential role during blood stage development. See also RMgm-84 for an independent, unsuccessful attempt to disrupt plasmepsin X P. berghei has 7 plasmepsins (aspartic proteases (PM IV-PM X). PM IV has a role in hemoglobin digestion (RMgm-314, RMgm-315, RMgm-316). P. falciparum PM V performs a critic role in the endoplasmic reticulum processing the PEXEL sequence of exported proteins. PM VI, VII, VII are not expressed in asexual blood stages; these are expressed in gametocytes/ookinetes/oocysts. PM VI plays an essential role in the formation of sporozoites within the oocyst (RMgm-97). | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: 
StudioDrie; S. Mededovic and A. van Wigcheren
StudioDrie; S. Mededovic and A. van Wigcheren