RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-878

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_0417600; Gene model (P.falciparum): PF3D7_0903800; Gene product: LCCL domain-containing protein (CCp4; LAP6) Name tag: EGFP
Phenotype	Fertilization and ookinete;

Last modified: 1 June 2013, 22:51

*RMgm-878

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 23684590
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	Saeed, S; Dessens, T
Name Group/Department	Department of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases
Name Institute	London School of Hygiene & Tropical Medicine
City	London
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-878
Principal name	PbLAP6/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	GFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malariapigment, characteristic of crystalloid targeting
Oocyst	Not different from wild type
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a C-terminal GFP-tagged version of LAP6 (CCp4). The tagged gene is under the control of the lap4 promoter region and the pbdhfr 3'UTR. Protein (function) The lap6 (ccp4) gene is a member of a small conserved gene family (6 genes), encoding proteins with multiple adhesive domains, for example a Lgl1 (LCCL)-lectin adhesive domain. In P. falciparum the LCCL domain-containing proteins are termed PfCCp's and in P. berghei PbLAP's Phenotype GFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malaria-pigment, characteristic of crystalloid targeting. No GFP expression in gametocytes and mature oocysts. mRNA is present in mature gametocytes indicating translational repression in gametocytes. Additional information Evidence has been presented in different studies for protein expression of LAP1, LAP2, LAP3 in gametocytes and ookinetes whereas protein expression of LAP4, LAP5 and LAP6 is absent in gametocytes. All proteins are associated with crystalloid bodies in ookinetes. See also mutants with different lap genes deleted: all these gene deletion studies show a defect during oocyst/sporozoite development. Other mutants

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0417600

Gene Model P. falciparum ortholog

PF3D7_0903800

Gene product

LCCL domain-containing protein

Gene product: Alternative name

CCp4; LAP6

top of page

Details of the genetic modification

Name of the tag

EGFP

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

Plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

To achieve GFP-tagging of PbLAP6 we adopted a strategy of single crossover homologous recombination. A ca. 1.9 kb fragment of pblap6 corresponding to the 3-part of the coding sequence was PCR amplified from genomic DNA with primers P1 (ACGAAGTTATCAGTCGACAGCCCCAGTTCAGACATAAAC) and P2 (ATGAGGGCCCCTAAGCTTTCTTTATGAGGAATAAATAAAATGTTTTTAAAC) and introduced into SalI/HindIII-digested pDNR-EGFP via in-fusion cloning(Takara Biotech) to give plasmid pDNR-PbLAP6/EGFP. The pblap6/egfp specific sequence was then transferred to pLP-hDHFR via cre-loxp recombination to give plasmid pLP-PbLAP6/EGFP

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	ACGAAGTTATCAGTCGACAGCCCCAGTTCAGACATAAAC
Additional information primer 1	P1
Sequence Primer 2	ATGAGGGCCCCTAAGCTTTCTTTATGAGGAATAAATAAAATGTTTTTAAAC
Additional information primer 2	P2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page