| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_1315300
|
| Gene Model P. falciparum ortholog |
PF3D7_1451600
|
| Gene product | LCCL domain-containing protein |
| Gene product: Alternative name | LAP5: FNPA |
| top of page |
| Details of the genetic modification |
| Name of the tag | EGFP |
| Details of tagging | C-terminal |
| Additional remarks: tagging | |
| Commercial source of tag-antibodies | |
| Type of plasmid/construct | Plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | The entire pblap5 coding sequence plus ca. 0.6 kb of upstream sequence was PCR amplified fromgenomic DNA with primers P5 (ACGAAGTTATCAGTCGAAGCTTCATACTGTTATATATTGCACATATAGCC) and P6 (ATGAGGGCCCCTAAGCTATTGTGGAGAAATATAATTTGTATAGATTG) and cloned into SalI/HindIII-digested pDNR-EGFP (RMgmDB-678) to give plasmid pDNR-PbLAP5/EGFP. The 3UTR of pblap5 was amplified with primers P7(CCTTCAATTTCGACATAGAGGCATTTGACAAACAAAC) and P8 (GCGGCCGCTCTAGCATAATGTTTTATTTTTTCCATTTTCAGC)and the resulting ca. 0.7 kb fragment cloned into NdeI-digested pLP-hDHFR by in-fusion cloning to give plasmid pLP-hDHFR/PbLAP5. The pblap5/egfp-specific sequence from pDNR-PbLAP5/EGFP was transferred to pLP-hDHFR/PbLAP5 by cre/loxp recombination to give the final construct pLP-PbLAP5/EGFP. Plasmid pLP-PbLAP5/EGFP was linearized with HindIII and SacII to remove the vector backbone prior to transfection. |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
|
| top of page |