Back to search resultsSummaryRMgm-876
|
||||||||
*RMgm-876| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23684590 Reference 2 (PMID number) : 30367865 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Saeed, S; Dessens, T |
| Name Group/Department | Department of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases |
| Name Institute | London School of Hygiene & Tropical Medicine |
| City | London |
| Country | UK |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-876 |
| Principal name | PbLAP4/GFP |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | GFP expression in ookinetes. Ookinetes exhibited GFP-based fluorescence that typically distributed to 2–3 regions visibly associated with clusters of malariapigment, characteristic of crystalloid targeting. However, crystalloid biogenisis is abnormal |
| Oocyst | Reduced growth of oocysts and premature sporogony |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation In reference PMID 30367865 (Saeed et al., 2018) a more detailed analysis of this mutants is provided. It is shown that: 'the LAP4 mutant that has abnormal crystalloid biogenesis and produces oocysts that display reduced growth and premature sporogony'. From the second paper PMID 30367865 (Saeed et al., 2018): 'In confocal microscopic examination, ookinetes and young oocysts of LAP4/GFP parasites possessed discrete fluorescent areas that co-localised strongly with pigment clusters, which is typical of crystalloid proteins. Electron microscopic examination of LAP4/GFP ookinetes revealed that the cells did not possess normal crystalloids, but instead had abnormal crystalloid-like structures that are absent in wild type and LAP null mutant ookinetes. To assess the effects of the crystalloid defect identified in the LAP4/GFP parasite on oocyst and sporozoite development, Anopheles stephensi vector mosquitoes were infected and parasite development was monitored in comparison with parasites that form normal crystalloids and display wild type sporogony (parasite line LAP3/GFP expressing LAP3::GFP)and with parasites that fail to form crystalloids and lack sporozoite formation (parasite line LAP3-KO, a LAP3 null mutant). |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1319500 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1455800 | ||||||||||||||||||||||||||
| Gene product | LCCL domain-containing protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | CCp2; LAP4 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | EGFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | A ca. 3 kb fragment of pblap4 corresponding to the 3'-part of the coding sequence was PCR amplified from genomic DNA withprimers P3 (ACGAAGTTATCAGTCGACAAGATGTCGAAAATATTTGTGCAT) and P4 (ATGAGGGCCCCTAAGCTTTCACATTCTGATATACACTGATTTATCA) and introduced into SalI/HindIII-digested pLP-PbLAP6/EGFP (see RMgm-878) to give pLP-PbLAP4/EGFP | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||