RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-837

Malaria parasite	P. berghei
Genotype
Disrupted	Gene model (rodent): PBANKA_1113000; Gene model (P.falciparum): PF3D7_0513300; Gene product: purine nucleoside phosphorylase (PNP)
Phenotype	No phenotype has been described

Last modified: 11 January 2018, 17:54

*RMgm-837

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene disruption
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 23402751
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	Niikura, M; Yuda, M; Kobayashi , F
Name Group/Department	Department of Infectious Diseases
Name Institute	Kyorin University School of Medicine
City	Tokyo
Country	Japan
top of page
Name of the mutant parasite
RMgm number	RMgm-837
Principal name	Δpbpnp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not tested
Fertilization and ookinete	Not tested
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant lacks expression of purine nucleoside phosphorylase (PNP) and expresses GFP under the control of the P. berghei hsp70 promoter. Protein (function) Plasmodium species are unable to synthesize purine rings de novo; instead, they rely on purine nucleosides from the host. During the asexual phase of malaria parasites, adenosine is converted to inosine by adenosine deaminase (ADA) in the purine salvage pathway. Hypoxanthine is produced from inosine by purine nucleoside phosphorylase (PNP). Phenotype Normal growth and multiplication of asexual blood stages. Parasites induce experimental cerebral complications in C57BL/6 mice. The normal growth of parasites lacking PNP suggests that these parasites are able to efficiently obtain hypoxanthine from other sources Additional information See also RMgm-838 for a P. yoelii YM mutant lacking expression of PNP. This mutant shows attenuation of growth of blood stages and mice are able to resolve infections. In addition, this mutant did not produce oocysts. Other mutants RMgm-838: P. yoelii YM mutant lacking expression of PNP

Disrupted: Mutant parasite with a disrupted gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1113000

Gene Model P. falciparum ortholog

PF3D7_0513300

Gene product

purine nucleoside phosphorylase

Gene product: Alternative name

PNP

top of page

Details of the genetic modification

Inducable system used

Additional remarks inducable system

Type of plasmid/construct used

(Linear) plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

KpnI, NotI

Partial or complete disruption of the gene

Complete

Additional remarks partial/complete disruption

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

eef1a

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

Δpbpnp parasites were generated by double-crossover homologous recombination. In Δpbpnp parasites, a selection cassette containing gfp and an hDHFR–ts fusion gene was integrated into the target gene (pbpnp)

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	AAAGGTACCTAAAATCCACGTAACCGCCA
Additional information primer 1	PNP–5’F
Sequence Primer 2	AAACTCGAGTCCAGGATCGCCAACAACTA
Additional information primer 2	PNP–5’R
Sequence Primer 3	AAAGGATCCATGAAGGGGATTTTGACAATC
Additional information primer 3	PNP–3’F
Sequence Primer 4	AAAGCGGCCGCGGATTTCATAAATGAGCTA
Additional information primer 4	PNP–3’R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page