RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-836
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1360100; Gene model (P.falciparum): PF3D7_1347200; Gene product: nucleoside transporter 1 (NT1)
Phenotype Asexual bloodstage;
Last modified: 11 January 2018, 17:52
  *RMgm-836
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23402751
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherNiikura, M; Yuda, M; Kobayashi , F
Name Group/DepartmentDepartment of Infectious Diseases
Name InstituteKyorin University School of Medicine
CityTokyo
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-836
Principal nameΔpbnt1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageReduced growth and multiplication of asexual blood stage parasites. Parasites do not induce experimental cerebral complications in C57BL/6 mice and mice can resolve infections.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of nucleoside transporter 1 (NT1) and expresses GFP under the control of the Plasmodium berghei hsp70 promoter.

Protein (function)
Plasmodium lacks the enzymatic machinery necessary for the synthesis of the purine ring de novo and rely solely on the uptake of host purines for DNA synthesis. For P. falciparum it has been demonstrated that the translocation of host purines into the parasite is mainly mediated by the plasma membrane permease PfNT1 (nucleotide transporter 1). Genetic studies demonstrated that PfNT1 plays an essential role in parasite development and replication within human erythrocytes and parasites lacking PfNT1 are conditionally lethal, growing only when purines are provided at supra-physiological concentrations (El Bissati et al., 2006, PNAS 103, 9286-91; El Bissati, 2008, Mol. Biochem. Parasitol. 161, 130-9).

Phenotype
Reduced growth and multiplication of asexual blood stage parasites. Parasites do not induce experimental cerebral complications in C57BL/6 mice and mice can resolve infections.

Additional information
See also RMgm-387 for a P. yoelii mutant lacking expression of NT1. Asexual blood stages of this mutant also show a strongly reduced growth and multiplication. Cloning of the P. yoelii mutant by limiting dilution was not possible (see 'Additional information').

Other mutants
RMgm-387: a P. yoelii mutant lacking expression of NT1


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1360100
Gene Model P. falciparum ortholog PF3D7_1347200
Gene productnucleoside transporter 1
Gene product: Alternative nameNT1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, NotI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationΔpbnt1 parasites were generated by double-crossover homologous recombination. In Δpbnt1 parasites and Δpbpnp parasites, a selection cassette containing gfp and an hDHFR–ts fusion gene was integrated into the target gene (pbnt1)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAAGGTACCTCATGCATAAGTAGCGATGC
Additional information primer 1NT1–5’F
Sequence Primer 2AAACTCGAGGCCGATTTTTGCGATGATTC
Additional information primer 2NT1–5’R
Sequence Primer 3AAAGGATCCGAAAAACACGGAATGACT G
Additional information primer 3NT1–3’F
Sequence Primer 4AAAGCGGCCGCATTTCATGATTGTTCG
Additional information primer 4NT1–3’R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6