Summary

RMgm-825
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0926700; Gene model (P.falciparum): PF3D7_1121600; Gene product: exported protein 1 | circumsporozoite-related antigen | parasitophorous vacuole membrane antigen QF 116 (CRA; EXP1; U43539 hepatocyte erythrocyte protein 17 kDa (HEP17))
PhenotypeNo phenotype has been described
Last modified: 16 August 2013, 18:38
  *RMgm-825
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 4
Reference (PubMed-PMID number) Not published (yet)
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherJ. Lin; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0926700
Gene Model P. falciparum ortholog PF3D7_1121600
Gene productexported protein 1 | circumsporozoite-related antigen | parasitophorous vacuole membrane antigen QF 116
Gene product: Alternative nameCRA; EXP1; U43539 hepatocyte erythrocyte protein 17 kDa (HEP17)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
TTTATACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTT
TTTGTGCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGA
AAAAAAAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTA
AATCCTATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTG
AAACAATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCT
CTTCAATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCAT
AGTTAAATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTT
CCTTCAATTTCGATTGATAATTCCTGCAGCCCAGCTTAATTCTTTTCGAGCTCTTTATGC
TTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGATATTGTG
CTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACCATTAAA
TTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCATGTAAAT
CAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAATTATGC
ATAAAAATTAAAGTGCCCTTTATTAACTAGAACTAGTCGTAATTATTTATATTTCTATGT
TATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATA
ATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACA
AAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAAT
ATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAAAT
TTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCA
GAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAACGAATTTAG
ATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTAT
GGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAA
TTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAG
TCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGT
CTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAA
ACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGA
TTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGA
GAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATGCTAGCGGAGGAGGTGG
ATCTGGTGGAGGTGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAAGTGGGATCAGAA
GGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGGTGGTGTTCCTAT
TGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGGTCACAACATGAG
ATTTCAAAAGGGATCCGCCACACTACATGGTGAGATCTCCACTTTGGAAAACTGTGGGAG
ATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTCTCCATGCGACAT
GTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGGTGAGAACGTTAA
TTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGTTGTTGTTGTTGA
CGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACCTCAGGATTGGTT
TGAAGATATTGGTGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCTACCTCAAACAAA
CCAATTGCTGGGTTTGTACACCATCATCAGAAATAAGAATACAACTAGACCTGATTTCAT
TTTCTACTCCGATAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAACCATCTACCTGT
GCAAAAGCAAATTGTGGAAACTGACACCAACGAAAACTTCGAAGGTGTCTCATTCATGGG
TAAAATCTGTGGTGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCAAGGATTAAGAGA
CTGTTGTAGGTCTGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGAGGAGACTGCTTT
ACCAAAGTTATTCTACGAAAAATTACCAGAGGATATATCTGAAAGGTATGTCTTCCTATT
AGACCCAATGCTGGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGTCTTGATTAAGAG
AGGTGTTAAGCCAGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAAGGAAGGGATTGA
AAAATACCATGCCGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCTCGACAGAGGTCT
AGATGAAAACAAGTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAGATACTACTGTGT
TTAACTCGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTG
TAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCT
AAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGC
TAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAA
ATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTAT
TATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTG
ATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAA
AAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACGTACCCTCGAGG
CTAGCGATATCGAATTCGTTAGCCTTACTAAGGTCATGCGATGAATTAAACTTTCTGTAT
ATTAATGGAGTCAAAATATTATTTTTTTAAATTAATAAAATAAAAGCCAATTTTTTTTTT
TAAATATTATGTCTCTAACTTTATGAAGATAAAAAAGGTTGTATTAATTCGAAAAAAGTA
ACATAAATATATATATTATTGTGTACATACATAATAATATGTATAAATTTGTGTTCCTTT
TATAAGCTTCATATTTTTAATAAAAAAAATATGAACAATGTTAATGTTGAGGAATGAATA
TGTTTTTTTAAAAAGTGATGAAATTCAAAAAATTAAAAACCATAATTGGGGACATTAAAA
AAAAATATACATAACTATGTTATGACCACAAACAATAAAAATAAATGAAATTTCAAATAA
TTGCGGATTCATATGTAGGGGTATTTACTCTTTTATATTTTTGTAGAAAATATGAAATAA
TAATTTTTGTTTTTTTTGTATCGAAAAAATAAATGTATGAAATATGTCGAATAACTCTTT
ATTATTGAAGGCCTTTATATTTGGATCACCATTTGGTATTTTATTATTCAATGAACTAAA
TAGAATTAAACATATTAAAGAAGATGAAAAATTAAACAAAAGTATATTTTTAAAAACATT
TCATAAAAGTAACATAATAAAAAATGATGAACCAGTTAGCACAAATCGATATAAGCAGGA
TACACCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGC
CCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAA
ACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTA
ATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAAT
GGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGA
CCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCG
CCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGAT
TTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTG
GGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATA
GTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATT
TATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAAT
TTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAA
TGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCAT
GAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCA
ACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCA
CCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTA
CATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTT
TCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGC
CGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTC
ACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGC
CATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA
GGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGA
ACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAAT
GGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACA
ATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCC
GGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCAT
TGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAG
TCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAA
GCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCA
TTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCC
TTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTC
TTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC
AGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTT
CAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTT
CAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGC
TGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAA
GGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGAC
CTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG
GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGA
GCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACT
TGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAA
CGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGC
GTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCG
CCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAAT
ACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTT
TCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTA
GGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGG
ATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTAACCC
TCACTAAAGGGAACAAAAGCTGGTACCGGGCCCCCCCTCGAGGTCGACATATTGTACATA
AGCCATTTTGCCATATATGTTTATAGTTTTTATAGCTAGTTTTAAATATAGTTATGCATA
GGTTAATATATATTTTTTGTTTGACTTTTATTATATTTAGGATTTTACTACACACTTGGA
TATGCACTATACAACATACATTATTAATTTTTCTGAGTTAATTTTTATTTTGCTTTTTCT
GAAAATTTATGTATTTTTTCTCACTATATTTATATTTTCATATATATTTTTTTTTAGCAT
AATTGAAAAATATAAAAGACATGTTTTATTCGAAAATATTGCAACACATTAAAAAATAAT
ACCTTATAATATTTTATATGTTCTTATTTCATGTCCCATATATAGAATTATATATATTAT
TATAAAATTTTAATGGACATAATTTTTACTTATTAATAATACAATTGGAATAATACAGAT
ATATACCTGATATTGCATATTATTACAAACCCGAGAATAAAATTAAATTATTCATAATTG
TAATGGAAACAATAATAAACGTTTTAAAACTTCATTTGTGTGACAATGCTGTCAATAATA
TTTATTTTGGTACACATTTTTTATGTTATTTTTTGAACAGTTGAATACAAAACAGATTTA
AAAGTTAGATGTGTATACATTTTTCTAATAACGATTATTTTGTTTTCAATATTTTTTTTT
TATAAATATAATTTTTGCTCAACTATGTTTTATGAATATTAATTATTTTCTATAACCATC
TTTTATAGTATACTTTGAAAAGGATGAAATAGTTAACAAATTAAAACTTAATAAAAAATG
TTTATAAATGTGAAAAAAGATGTAAATATTTATGCTTTTTATTCAAAGAAAAAAGTCATT
TTTAATTTCATTATTAAAATGAAATAATCCACATAAAAATAATTAATGATTTTTATTTTT
ATGTAGCTCCTCCTTTTCATGGCCTAATA
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationSeveral unsuccessful attempts to disrupt the gene (1542; 1611).

The unsuccessful attempts indicate an essential role during blood stage development/multiplication.

The experiment was unsuccessfully repeated twice with the plasmid described.

Two more unsuccessful attempts to disrupt the gene were carried out using a linear construct that was generated using a 2-step, anchor tagging PCR method.

The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs L5213 & L5214 (GAACTCGTACTCCTTGGTGACGGGTACCTATTTTTATGTAGCTCCTCC / CATCTACAAGCATCGTCGACCTCAGAAAATATAGTGCTATATGTG) and L5215 & L5216 (CCTTCAATTTCGGATCCACTAGTATCATAAAAAGTTTCGACTC / AGGTTGGTCATTGACACTCAGCAGTACTTTAATGTCCCCAATTATGG). Primers L5214 and L5215 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers L5213 and L5216 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction.

The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers L4661 (GAACTCGTACTCCTTGGTGACG) and L4662 (AGGTTGGTCATTGACACTCAGC), resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group.

To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product.

For a more detailed understanding of the 2-step anchor tagging PCR method, please see the following publications:

J.W. Lin, S.M. Khan et al
A novel 'gene insertion/marker out' (GIMO) method for transgene expression and gene complementation in rodent malaria parasites
PLoS One. 2011;6(12)

T. Annoura et al
Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates
Vaccine. 2012 Mar 30;30(16):2662-70
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATGCTCGTCGACATATTGTACATAAGCCATTTTGCC
Additional information primer 1L3953; 5’- hep17 targeting region F (SalI)
Sequence Primer 2ATGCTCAAGCTTAGGCCATGAAAAGGAGGAGC
Additional information primer 2L3955; 5’- hep17 targeting region R (HindIII)
Sequence Primer 3ATGCTCGAATTCGTTAGCCTTACTAAGGTCATGCG
Additional information primer 3L3956; 3’- hep17 targeting region F (EcoRI)
Sequence Primer 4ATGCTCCCCGGGTGTATCCTGCTTATATCGATTTGTGC
Additional information primer 4L3957; 3’- hep17 targeting region R (XmaI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6