SummaryRMgm-825
|
||||||||||
*RMgm-825| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 4 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | J. Lin; C.J. Janse; S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0926700 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1121600 | ||||||||||||||||||||||||
| Gene product | exported protein 1 | circumsporozoite-related antigen | parasitophorous vacuole membrane antigen QF 116 | ||||||||||||||||||||||||
| Gene product: Alternative name | CRA; EXP1; U43539 hepatocyte erythrocyte protein 17 kDa (HEP17) | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGGGCCCCCGCGGTGGCGGCCGCTCTAGCTTTGATCCCGTTTTTCTTACTTATATA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
| Additional remarks genetic modification | Several unsuccessful attempts to disrupt the gene (1542; 1611). The unsuccessful attempts indicate an essential role during blood stage development/multiplication. The experiment was unsuccessfully repeated twice with the plasmid described. Two more unsuccessful attempts to disrupt the gene were carried out using a linear construct that was generated using a 2-step, anchor tagging PCR method. The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs L5213 & L5214 (GAACTCGTACTCCTTGGTGACGGGTACCTATTTTTATGTAGCTCCTCC / CATCTACAAGCATCGTCGACCTCAGAAAATATAGTGCTATATGTG) and L5215 & L5216 (CCTTCAATTTCGGATCCACTAGTATCATAAAAAGTTTCGACTC / AGGTTGGTCATTGACACTCAGCAGTACTTTAATGTCCCCAATTATGG). Primers L5214 and L5215 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers L5213 and L5216 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers L4661 (GAACTCGTACTCCTTGGTGACG) and L4662 (AGGTTGGTCATTGACACTCAGC), resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group. To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product. For a more detailed understanding of the 2-step anchor tagging PCR method, please see the following publications: J.W. Lin, S.M. Khan et al A novel 'gene insertion/marker out' (GIMO) method for transgene expression and gene complementation in rodent malaria parasites PLoS One. 2011;6(12) T. Annoura et al Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates Vaccine. 2012 Mar 30;30(16):2662-70 | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||