RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-823
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1354100; Gene model (P.falciparum): PF3D7_1340700; Gene product: ras-related protein Rab-11B (RAB11b; Rab GTPase 11b)
PhenotypeNo phenotype has been described
Last modified: 6 April 2015, 10:29
  *RMgm-823
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Not published (yet)
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherJ. Lin; C.J. Janse; Langsley, G
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1354100
Gene Model P. falciparum ortholog PF3D7_1340700
Gene productras-related protein Rab-11B
Gene product: Alternative nameRAB11b; Rab GTPase 11b
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe gene deltion construct was provided by Gordon Langsley, Paris
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAGCTTGGGAAACACAATTAAAGG
Additional information primer 15’UTR-rab11b-HindIII DI (3)
Sequence Primer 2CTGCAGCCGAAAAAATGTTAT
Additional information primer 25’UTR-rab11b-PstI RE
Sequence Primer 3GGTACCGCAAAAAAATATGTAAATTTCCA
Additional information primer 33’UTR-rab11b-KpnI DI
Sequence Primer 4GAATTCTTTGCACAATAACTGATTTATATT
Additional information primer 43’UTR-rab11b-EcoRI RE (4)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren