RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-821

Malaria parasite	P. berghei
Genotype
Genetic modification not successful
Disrupted	Gene model (rodent): PBANKA_0308000; Gene model (P.falciparum): PF3D7_0211200; Gene product: ras-related protein Rab-5A (RAB5a; Rab GTPase 5a)
Phenotype	No phenotype has been described

Last modified: 6 April 2015, 10:28

*RMgm-821

Successful modification	The gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted	Gene disruption
Number of attempts to introduce the genetic modification	≥ 5
Reference (PubMed-PMID number)	Not published (yet)
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA cl15cy1
Other information parent line	A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255)
top of page
Attempts to generate the mutant parasite were performed by
Name PI/Researcher	J. Lin; C.J. Janse; Langsley, G
Name Group/Department	Leiden Malaria Research Group
Name Institute	Leiden University Medical Center
City	Leiden
Country	The Netherlands

Disrupted: Mutant parasite with a disrupted gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0308000

Gene Model P. falciparum ortholog

PF3D7_0211200

Gene product

ras-related protein Rab-5A

Gene product: Alternative name

RAB5a; Rab GTPase 5a

top of page

Details of the genetic modification

Inducable system used

Additional remarks inducable system

Type of plasmid/construct used

(Linear) plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Partial or complete disruption of the gene

Complete

Additional remarks partial/complete disruption

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

Attempts to disrupt the gene were carried out in the WT background (cl15cy1) as well as is the 676m1cl1 (RMgm-29) and 1037m1f1mocl1 (RMgm-32) background.

The following gene deletion plasmid was obtained from Gordon Langsley (Paris):
The pDH-GPF-Rab5A plasmid was made in a two-step procedure: first the Pbrab5a fragment was PCR amplified with the primers PbCDS5a-For (GCATTAGTTAAAAAAAATGAgctcATGGAAAAG; SacI site is underlined), and PbCDS5a-Rev (GTATATGGCTATATAAGcTTGGATGC; HindIII site is underlined) using P. berghei cDNA as template, the 5’-UTR fragment was PCR amplified with the primers Pbrab5a-5’UTR-KI-For (GTCAGGAATAaGCTTTTGGGG; HindIII site is underlined) and Pbrab5a-5’UTR-KI-Rev (CTTTTCTTTTCCATTTgTCgAcTTTTTTTAAC; SalI site is underlined) and the GFP gene was PCR amplified with the primers GFP-For (CGCGCGGTCGACATGAGTAAAGGAGAAGAAC; SalI site is underlined) and GFP-Rev (CCCGGGGAGCTCTTGTTTGTATAGTTCATCCA; SacI site is underlined and the stop codon mutated). Each fragment was cloned using the TA Cloning ®Simplifies PCR Cloning kit (Invitrogen), the plasmids were digested with the appropriate enzyme and cloned into the pDEF-hDHFR targeting vector resulting in plasmid pDH-GFP-Rab5A. Transfection was performed using 5μg of pDH-GFP-rab5a DNA fragment.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page