RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-821
|
||||||||||
Last modified: 6 April 2015, 10:28
*RMgm-821| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | ≥ 5 |
| Reference (PubMed-PMID number) | Not published (yet) |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255) |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | J. Lin; C.J. Janse; Langsley, G |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0308000 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0211200 | ||||||||||||||||||||||||
| Gene product | ras-related protein Rab-5A | ||||||||||||||||||||||||
| Gene product: Alternative name | RAB5a; Rab GTPase 5a | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | Attempts to disrupt the gene were carried out in the WT background (cl15cy1) as well as is the 676m1cl1 (RMgm-29) and 1037m1f1mocl1 (RMgm-32) background. The following gene deletion plasmid was obtained from Gordon Langsley (Paris): The pDH-GPF-Rab5A plasmid was made in a two-step procedure: first the Pbrab5a fragment was PCR amplified with the primers PbCDS5a-For (GCATTAGTTAAAAAAAATGAgctcATGGAAAAG; SacI site is underlined), and PbCDS5a-Rev (GTATATGGCTATATAAGcTTGGATGC; HindIII site is underlined) using P. berghei cDNA as template, the 5’-UTR fragment was PCR amplified with the primers Pbrab5a-5’UTR-KI-For (GTCAGGAATAaGCTTTTGGGG; HindIII site is underlined) and Pbrab5a-5’UTR-KI-Rev (CTTTTCTTTTCCATTTgTCgAcTTTTTTTAAC; SalI site is underlined) and the GFP gene was PCR amplified with the primers GFP-For (CGCGCGGTCGACATGAGTAAAGGAGAAGAAC; SalI site is underlined) and GFP-Rev (CCCGGGGAGCTCTTGTTTGTATAGTTCATCCA; SacI site is underlined and the stop codon mutated). Each fragment was cloned using the TA Cloning ®Simplifies PCR Cloning kit (Invitrogen), the plasmids were digested with the appropriate enzyme and cloned into the pDEF-hDHFR targeting vector resulting in plasmid pDH-GFP-Rab5A. Transfection was performed using 5μg of pDH-GFP-rab5a DNA fragment. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
 Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||