Mutant/mutation
The mutant lacks expression of DPAP1.

Protein (function)
Evidence has been presented that the P. falciparum enzyme dipeptidyl aminopeptidase 1 (DPAP1; an ortholog of the lysosomal exopeptidase cathepsin C) was located in the food/digestive vacuole and to possesses hydrolytic activity against dipeptide substrates, suggesting that DPAP1 is involved in the generation of dipeptides from hemoglobin-derived oligopeptides. The dpap1 gene could not be deleted from the P. falciparum genome, suggesting an essential role during blood stage growth/multiplication.

The P. falciparum and P. berghei genomes each contain three dipeptidyl aminopeptidase (dpap) homologs. P. falciparum DPAP1 and DPAP3 are critical for asexual growth. The P. falciparum dpap2 gene could be deleted. Parasites lacking expression of (the gametocyte-specific?) DPAP2 produced normal gametocytes.
In P. berghei all three dpap genes can be deleted from the genome (see below).

Phenotype
Blood stages show a reduced growth rate (and a normal hemozoin production)

Additional information
An independent mutant (DPAkocl5, ∆dpap1-a)  was generated in the reference P. berghei ANKA line 1037m1f1cl1 by the group of Roberta Spaccapelo (University of Perugia, Italy) using a circular, double cross-over targeting plasmid (pLDPA). The 5' targeting region was amplified using primer pair R578/R579 (CCGGGCCCGCGGGCATGTAATGCGTATATTCG / CCATCGATCGAATTTTGGGGTTAATTATATCC). The 3' targeting region was amplified using primer pair R580/R581 (GGGGTACCGAGTATATGCTTTCATGGAAATG / CGGGATCCTCATAATTCATTAAAAGTGATATTAAAG).

Generation of the P. berghei mutants ∆dpap1 (RMgm-810), ∆dpap2 (RMgm-811) and ∆dpap3 (RMgm-812).
(primer sequences can either be found in Lin et al. (2015). J. Exp. Med. or obtained from the Leiden Malaria Research Group)
(A) Schematic representation of the gene-deletion constructs targeting the ORF of genes expressing dipeptidyl peptidases 1-3 (dpap1-3) by double cross-over homologous recombination and the wt gene loci before and after disruption. The constructs contain a drug-selectable marker cassette (SM; black box) and gene target regions (hatched boxes). Primer positions (arrows) for diagnostic PCRs are shown (see Table S4 for primer sequences and expected product sizes). (B) Diagnostic PCR (left, center) and RT-PCR (right) analysis confirm correct disruption of dpap1 in ∆dpap1-a. For diagnostic PCRs, the following primers were used: 5’ in, RS672/RS32; 3’ in, RS110/RS673; SM (tgdhfr/ts), RS404/RS405; dpap1 ORF, RS582/RS583. For RT-PCR the following primers were used: tub (tubulin), RS782/RS783 and dpap1, RS582/RS583. (C) Diagnostic PCR (left) and Southern analysis of pulsed field gel-separated (center) confirm correct disruption of dpap1 in ∆dpap1-b. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap1 transcripts in the ∆dpap1-a mutant. The following primers were used for diagnostic PCRs: 5' integration (5’ in), L6204/L4770; 3' integration (3’ in), L4771/L6205; SM (hdfhr::yfcu), L4698/L4699; dpap1 ORF, L6206/L6207. For Southern analysis, separated chromosomes were hybridized using an hdhfr probe that recognizes the construct integrated into the dpap1 locus on chromosome 9. Northern blot was hybridized using a PCR probe recognizing the dpap1 ORF (primers L6206/L6207). As a loading control, hybridization was performed with oligonucleotide probe L644R that recognizes the large subunit rRNA. (D) Diagnostic PCR (left) and Southern analysis of pulsed field gel-separated chromosomes (center) confirms correct disruption of dpap2 in mutant ∆dpap2. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap2 transcripts in the ∆dpap2 mutant. The following primers were used for diagnostic PCRs: 5’ in, L6935/L4770; 3’ in, L4771/L6936; SM (hdfhr::yfcu), L4698/L4699; dpap2 ORF, L6937/L6938. Separated chromosomes were hybridized using a 3’UTR pbdhfr probe that recognizes the construct integrated into dpap2 on chromosome 14, the endogenous dhfr/ts on chromosome 7 and the GFP-luciferase reporter cassette in the 230p locus on chromosome 3. Northern blot was hybridized using a PCR probe recognizing the dpap2 ORF (primers L6937/L6938) and with an oligonucleotide probe L644R recognizing the large subunit rRNA (as loading control). (E) Diagnostic PCR (left) and Southern analysis of pulsed field gelseparated chromosomes (center) confirm correct disruption of dpap3 in ∆dpap3-a and ∆dpap3-b. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap3 transcripts. The following primers were used for diagnostic PCRs: 5’ in, L6941/L4770; 3’ in, L4771/L6942; SM (hdfhr::yfcu), L4698/L4699; dpap3 ORF, L6943/L6944. Separated chromosomes were hybridized using a 3’UTR pbdhfr probe that recognizes the construct integrated into dpap3 on chromosome 10, the endogenous dhfr/ts on chromosome 7 and the GFP-luciferase reporter cassette in the 230p locus on chromosome 3. Northern blot was hybridized using a PCR probe recognizing the dpap3 ORF (primers L6943/L6944) and with an oligonucleotide probe L644R recognizing the large subunit rRNA (as loading control). See Table S4 for primers used for generation of probes.

Other mutants
RMgm-811: mutant lacking expression of DPAP2
RMgm-812: mutant lacking expression of DPAP3