Back to search resultsSummaryRMgm-810
|
||||||||
*RMgm-810| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25941254 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255) |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J. Lin; C.J. Janse; S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-810 |
| Principal name | 1962cl1 |
| Alternative name | ∆dpap1-b |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Blood stages show a reduced growth rate (and a normal hemozoin production) |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation
Generation of the P. berghei mutants ∆dpap1 (RMgm-810), ∆dpap2 (RMgm-811) and ∆dpap3 (RMgm-812). Other mutants |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0931300 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1116700 | ||||||||||||||||||||||||
| Gene product | dipeptidyl aminopeptidase 1 | cathepsin C, homolog | ||||||||||||||||||||||||
| Gene product: Alternative name | DPAP1 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) PCR construct double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GAACTCGTACTCCTTGGTGACGAAGCTTGCATGTAATGCGTATATTCGTTTTTTAACAAA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The locus was targeted using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hdhfr::yfcu selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hdhfr::yfcu selectable marker cassette used in this reaction was digested from pL0048 using restriction enzymes XhoI and NotI. pL0048 is available from The Leiden Malaria Research Group. See for more information on the 2-step anchor tagging PCR method, the following publications: J.W. Lin, S.M. Khan et al. A novel 'gene insertion/marker out' (GIMO) method for transgene expression and gene complementation in rodent malaria parasites PLoS One. 2011;6(12). T. Annoura et al. Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates Vaccine. 2012;30(16):2662-70. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||