RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-806
|
||||||||||
Last modified: 23 December 2016, 17:40
*RMgm-806| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 4 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25941254 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 1037m1f1mocl1 (RMgm-32) |
| Other information parent line | P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | J. Lin; C.J. Janse; S.M. Khan |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1410300 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1311800 | ||||||||||||||||||||||||
| Gene product | M1-family alanyl aminopeptidase | ||||||||||||||||||||||||
| Gene product: Alternative name | M1AAP | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) PCR construct double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||
| Plasmid/construct sequence |
GAACTCGTACTCCTTGGTGACGTCGCGAATAATAGTATAAAGGGAATTATATGCTAACTT
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The unsuccessful attempts to delete this gene indicates an essential role for blood stage growth/multiplication. Aminopeptidases catalyze N-terminal peptide bond hydrolysis and occupy many diverse roles across all domains of life. Plasmodium falciparum. M1AAP is abundant in two subcellular compartments in asexual intraerythrocytic parasites; that is, the food vacuole, where the catabolism of host hemoglobin takes place, and the nucleus. In the first unsuccessful attempt to disrupt the gene described here (experiment 2058), the locus was targeted using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hdhfr::yfcu selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hdhfr::yfcu selectable marker cassette used in this reaction was digested from pL0048 using restriction enzymes XhoI and NotI. pL0048 is available from The Leiden Malaria Research Group. See for more information on the 2-step anchor tagging PCR method, the following publications: J.W. Lin, S.M. Khan et al. A novel 'gene insertion/marker out' (GIMO) method for transgene expression and gene complementation in rodent malaria parasites PLoS One. 2011;6(12). T. Annoura et al. Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates Vaccine. 2012;30(16):2662-70 The experiment was repeated twice without success using the same PCR targeting construct in the 820cl1m1cl1 (RMgm-164) background (experiment 2087) and once more in the 1037m1f1cl1 background (2111). A third independent unsuccessful attempt was done by the group of Roberta Spaccapelo (University of Perugia, Italy) in the 676m1cl1 (RMgm-29) background using a circular, double cross-over targeting plasmid (pLTgAPN). The 5' targeting region was amplified using primer pair R715/R716 (GGGGGGGCCCGCGGCTTATTGTATCCCTTGGCATTTG / GGGGATCGATATCGTATAGTATTATTTATCATGCAAG). The 3' targeting region was amplified using primer pair R717/R718 (GGGGGAATTCACAAATAAAATGTGAAAGTAAAGTTTTAC / AAGGAAAAAAGCGGCCGCTGTGAGACTTTCCATATAAGGAATAC) | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||