RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-80
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0509500; Gene model (P.falciparum): PF3D7_1025300; Gene product: conserved Plasmodium protein, unknown function (PSOP21, putative secreted ookinete protein 21)
PhenotypeNo phenotype has been described
Last modified: 6 October 2010, 10:08
  *RMgm-80
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0509500
Gene Model P. falciparum ortholog PF3D7_1025300
Gene productconserved Plasmodium protein, unknown function
Gene product: Alternative namePSOP21, putative secreted ookinete protein 21
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption gene disruption (fragment encoding N-terminal 502(Pf) amino acids retained)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationIMPORTANT NOTE: The new P. berghei annotation, in GeneDB, has revealed that the primers for the (5’ and 3’) targeting regions are located in TWO different genes (PBANKA_050950 and PBANKA_050940). Therefore the integration of this construct would target both genes, i.e. generating a partial deletion of PBANKA_050950 and a complete deletion of PBANKA_050940. The failure to disrupt/knock-out PBANKA-050950 might, therefore, be due to the unintentional disruption of PBANKA_050940.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCCAAAGGGAATATGGAATATTTAG
Additional information primer 1AE21a (ApaI); 5'
Sequence Primer 2CCAAGCTTACATCATCAGTATTTTTACAATC
Additional information primer 2AE21b (HindIII); 5'
Sequence Primer 3TGAATTCATATTAATAAGTTAGGCGAAACC
Additional information primer 3AE21c (EcoRI); 3'
Sequence Primer 4GGGGATCCTGCACATATTATATGCTTAACTG
Additional information primer 4AE21d (BamHI); 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
P.berghei model of malaria
Technical design and realization: S. Mededovic and A. van Wigcheren