top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
Transgene name | GFP |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
ScaI, SalI
|
Selectable marker used to select the mutant parasite | hdhfr/yfcu |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The construct to delete the aqp gene contains a GFP expression cassette. In this cassette the gfp gene is under the control of the hsp70 promoter (see for more information on the basic plasmid pBAT-SIL6 the mutant RMgm-757).
Parasites with their AQP disrupted were generated using the standard gene replacement strategy. First, a 526 bp fragment of the 3' untranslated region (UTR) was amplified by PCR from genomic DNA using the primer combination AQP-F5-AvrII and AQP-R4-KpnI and cloned into the pBAT-SIL6 vector (Kooij et al., 2012) using AvrII and KpnI restriction digestion to generate the intermediate construct pAQP-IM. For the generation of the AQP disruption construct, pAQP-KO, a 557 bp fragment of the 5'UTR was amplified from gDNA using the primer combination AQP-F2-SacII and AQP-R1-EcoRI. This fragment was subcloned, using EcoRI and SacII, into an intermediate pBAT-derived vector. Subsequently, it was released by cleavage with HpaI and SacII, and cloned into pAQP-IM using SacII and PvuII. The resulting plasmid was linearized with ScaI and SalI and transfected into WT P. berghei ANKA strain parasites. |
Additional remarks selection procedure | The mutant parasite is cloned by FACS sorting (and not by limiting dilution) based on GFP expression. |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0711900
|
Gene Model P. falciparum ortholog |
PF3D7_0818900
|
Gene product | heat shock protein 70 |
Gene product: Alternative name | HSP70 |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_1340000
|
Gene product | dihydrofolate synthase/folylpolyglutamate synthase, putative |
Gene product: Alternative name | PbDHFS-FPGS |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Replacement locus |
Gene Model of Parasite |
PBANKA_0915600
|
Gene product | aquaglyceroporin |
Gene product: Alternative name | AQP |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | AATCCTAGGCATTATTATAAAATATATTTGTGAGACTG |
Additional information primer 1 | AQP-F5-AvrII; 3' untranslated region |
Sequence Primer 2 | ATAGGTACCTTGCAAATCTGTCTTGTCGTC |
Additional information primer 2 | AQP-R4-KpnI; 3' untranslated region |
Sequence Primer 3 | AAACCGCGGCTTAAAAAGTATAAATGACTGTAAAAGAG |
Additional information primer 3 | AQP-F2-SacII; 5' untranslated region |
Sequence Primer 4 | AAAGAATTCTTAATTAAGATATTTTTCTTTTGAAAAAAAATAAAATAATATATATAA |
Additional information primer 4 | AQP-R1-EcoRI; 5' untranslated region |
|
|
top of page |