RMgmDB - Rodent Malaria genetically modified Parasites
Back to search resultsSummaryRMgm-780
|
||||||||
Last modified: 11 August 2014, 18:35
*RMgm-780| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) | Not published (yet) |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255) |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | J.A. Eken; O. Klop; B.M.D. Franke-Fayard; C.J. Janse |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-780 |
| Principal name | 2190 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | Expression of the mCherry-tagged protein in blood stages |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Figure: mCherry::PBANKA_142630 expression in blood stages. Nuclear staining with Hoechst (blue); erthrocyte membrane staining with anti-TER antibodies (green). Southern analysis of separated chromosomes (right) confirms integration of the construct into chromosome 14 (hybridisation with the 3'UTR Pbdhfr/ts gene recognizing the integrated construct in chr. 14 and the endogenous dhfr/ts gene on chr. 7) |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1426300 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0811200 | ||||||||||||||||||||||||||
| Gene product | ER membrane protein complex subunit 1, putative | ||||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | mCherry | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
  
| ||||||||||||||||||||||||||
| Plasmid/construct sequence |
GTCACTACTTTTAATCGCATAGATGGATCTATAAATCAACCAAATGAATTAAGCTTGTTT
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | NdeI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: 
StudioDrie; S. Mededovic and A. van Wigcheren
StudioDrie; S. Mededovic and A. van Wigcheren