| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_1437600
|
| Gene Model P. falciparum ortholog |
PF3D7_1222700
|
| Gene product | glideosome-associated protein 45 |
| Gene product: Alternative name | GAP45 |
| top of page |
| Details of the genetic modification |
| Short description of the mutation | 'Promoter swap' mutant: the promoter of GAP45 replaced by the promoter of ama1 (PBANKA_091500) |
| Inducable system used | No |
| Short description of the conditional mutagenesis | Not available |
| Additional remarks inducable system |
|
| Type of plasmid/construct | Plasmid double cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | For the double-crossover promoter-exchange plasmid, a parent vector Pama1 was first constructed containing the ama1 promoter. For Pama1, 1.5 kb of the upstream sequence of the ama1 gene (PBANKA_083630) was cloned downstream of the hdhfr cassette in pDEFhDHPEA. The Pama1-gap45 (pSS370) vector was subsequently made by inserting a gap45 5’ homology region upstream of the hdhfr cassette in Pama1 (consisting of 500 bp of gap45 upstream sequence), and a 3’ homology region downstream of the ama1 promoter (consisting of the first 500 bp of gap45 coding sequence). |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences 
Primer information: Primers used for amplification of the target sequences
| Sequence Primer 1 | gagaccgcggcaggaatatcttatatagc |
| Additional information primer 1 | olSS927; 5’HR GAP45 forward |
| Sequence Primer 2 | gagactgcaggcaaatcggtataatgtctta |
| Additional information primer 2 | olSS928; 5’HR GAP45 reverse |
| Sequence Primer 3 | gagactcgagatgggaagcagatgttcaa |
| Additional information primer 3 | olSS929; 3’HR GAP45 forward |
| Sequence Primer 4 | gagagcggccgcgatatcggataaatcaatctttc |
| Additional information primer 4 | olSS930; 3’HR GAP45 reverse |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
|
| top of page |