RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-775

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_1459500; Gene model (P.falciparum): PF3D7_1246400; Gene product: myosin light chain 1 \| myosin A tail domain interacting protein (MLC1; MTIP) Details mutation: 'Promoter swap' mutant: the promoter of MTIP replaced by the promoter of ama1 (PBANKA_091500)
Phenotype	Fertilization and ookinete;

Last modified: 22 September 2012, 21:43

*RMgm-775

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 22817984
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	S. Sebastian; O. Billker
Name Group/Department	Not applicable
Name Institute	Wellcome Trust Sanger Institute
City	Hinxton, Cambridge
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-775
Principal name	Pama1-mtip
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Normal numbers of mature ookinetes are formed. Expression of MTIP was absent in mutant ookinetes. Ookinetes are devoid of motility.
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation In the promoter swap' mutant: the promoter of the endogenous mtip gene is replaced by the promoter of ama1 (PBANKA_091500). Protein (function) MTIP is part of the actomyosin motor located under the surface membrane of the invasive/motile stages of the parasite. In this motor, actin filaments attached to membrane proteins bind an atypical myosin (MyoA), which is in turn attached by its C-terminal end to a sub-pellicular structure called the inner membrane complex (IMC) via a myosin light chain (or myosin A tail domain interacting protein, MTIP). MyoA, MTIP and the 45 kDa glideosome associated protein (GAP45) cotranslationally form a complex, which interacts with other proteins such as GAP50 at the IMC. Phenotype MTIP is considered vital for blood stage development/multiplication (merozoite invasion of erythrocytes). In the 'promoter-swap' mutant the promoter of mtip is replaced by an 'asexual blood stage’ promoter that is silent (or has a strongly reduced activity) in ookinetes (the promoter of ama1, PBANKA_091500). Expression of MTIP was absent in mutant ookinetes whereas wild type ookinetes express MTIP. Phenotype analyses of the promoter swap mutant indicate that MTIP has an essential role in ookinete motility Additional information Other mutants

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1459500

Gene Model P. falciparum ortholog

PF3D7_1246400

Gene product

myosin light chain 1 | myosin A tail domain interacting protein

Gene product: Alternative name

MLC1; MTIP

top of page

Details of the genetic modification

Short description of the mutation

'Promoter swap' mutant: the promoter of MTIP replaced by the promoter of ama1 (PBANKA_091500)

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

For the double-crossover promoter-exchange plasmid, a parent vector Pama1 was first constructed containing the ama1 promoter. For Pama1, 1.5 kb of the upstream sequence of the ama1 gene (PBANKA_083630) was cloned downstream of the hdhfr cassette in pDEFhDHPEA. Pama1-mtip (pSS369) vector was subsequently made by inserting a mtip 5’ homology region upstream of the hdhfr cassette in Pama1 (consisting of 500 bp of mtip upstream sequence), and a 3’ homology region downstream of the ama1 promoter (consisting of the first 500 bp of mtip coding sequence).

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	gagaccgcggttactatatatgtgtagaaatg
Additional information primer 1	olSS1016; 5’HR MTIP forward
Sequence Primer 2	gagactgcagttttgcgatatatattttttaaattaa
Additional information primer 2	olSS1017; 5’HR MTIP reverse
Sequence Primer 3	gagactcgagatggaacaacaatgccatat
Additional information primer 3	olSS1018; 3’HR MTIP forward
Sequence Primer 4	gagagcggccgcgatatcctcgcaaaataatttataat
Additional information primer 4	olSS1019; 3’HR MTIP reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page