RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-774

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_1355700; Gene model (P.falciparum): PF3D7_1342600; Gene product: myosin A (MyoA; M-A) Details mutation: 'Promoter swap' mutant: the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)
Phenotype	Fertilization and ookinete;

Last modified: 22 September 2012, 21:45

*RMgm-774

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 22817984
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	S. Sebastian; O. Billker
Name Group/Department	Not applicable
Name Institute	Wellcome Trust Sanger Institute
City	Hinxton, Cambridge
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-774
Principal name	Pama1-myoa
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Normal numbers of mature ookinetes are formed. Expression of MyoA was absent in mutant ookinetes. Ookinetes are devoid of motility.
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation In the promoter swap' mutant: the promoter of the endogenous myosin A gene is replaced by the promoter of ama1 (PBANKA_091500). Protein (function) Myosin A is the founding member of unconventional class XIV myosins. These myosins are remarkably small, essentially composed of the actin-interacting ATPase domain, followed by a very short tail domain. Class XIV myosins are exclusively found in the Alveolata branch of eukaryotic organisms, including the Apicomplexa. Plasmodium Myosin A is considered vital for merozoite invasion of erythrocytes. Myosin A is a component of the glideosome of apicomplexan parasites, which is an actin- and myosin-based machine located at the pellicle, between the plasma membrane (PM) and inner membrane complex (IMC), that powers parasite motility, migration, and host cell invasion and egress. It is composed of myosin A, its light chain MLC1, and two gliding-associated proteins, GAP50 and GAP45 Phenotype Myosin A is considered vital for blood stage development/multiplication (merozoite invasion of erythrocytes). In the 'promoter-swap' mutant the promoter of myosin A is replaced by an 'asexual blood stage’ promoter that is silent (or has a strongly reduced activity) in ookinetes (the promoter of ama1, PBANKA_091500). Expression of MyoA was absent in mutant ookinetes whereas wild type ookinetes express MyoA. Phenotype analyses of the promoter swap mutant indicate that Myosin A has an essential role in ookinete motility Additional information Other mutants RMgm-656: independent promoter exchange mutant expressing MyoA from the ama1 promoter

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1355700

Gene Model P. falciparum ortholog

PF3D7_1342600

Gene product

myosin A

Gene product: Alternative name

MyoA; M-A

top of page

Details of the genetic modification

Short description of the mutation

'Promoter swap' mutant: the promoter of myosin A replaced by the promoter of ama1 (PBANKA_091500)

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

For the double-crossover promoter-exchange plasmid, a parent vector Pama1 was first constructed containing the ama1 promoter. For Pama1, 1.5 kb of the upstream sequence of the ama1 gene (PBANKA_083630) was cloned downstream of the hdhfr cassette in pDEFhDHPEA. The Pama1-myoA (pSS368) vector was subsequently made by inserting a myoA 5’ homology region upstream of the hdhfr cassette in Pama1 (consisting of 500 bp of myoA upstream sequence), and a 3’ homology region downstream of the ama1 promoter (consisting of the first 500 bp of myoA coding sequence)

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	gagaccgcggcattgaagaattgtattttgttac
Additional information primer 1	olSS1066; 5’HR MyoA forward
Sequence Primer 2	gagactgcagcgagaaacgagaaaaatcaaaatt
Additional information primer 2	olSS1067; 5’HR MyoA reverse
Sequence Primer 3	gagactcgagatggctgttacaaatgaggaat
Additional information primer 3	olSS1068; 3’HR MyoA forward
Sequence Primer 4	gagagcggccgcgttaacgccatgtaaatttgataaag
Additional information primer 4	olSS1069; 3’HR MyoA reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page