top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0314200
|
Gene Model P. falciparum ortholog |
PF3D7_0217500
|
Gene product | calcium-dependent protein kinase 1 |
Gene product: Alternative name | CDPK1; CPK |
top of page |
Details of the genetic modification |
Name of the tag | GFP |
Details of tagging | C-terminal |
Additional remarks: tagging | gfp fused in frame with the open reading frame of the endogenous cdpk1 gene |
Commercial source of tag-antibodies | anti-GFP rabbit polyclonal (Invitrogen) |
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
HpaI
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | For c-terminal GFP tagging of the the cdpk1 genomic locus, the terminal 1.5 kb of cdpk1 without the stop-codon was PCR amplified using oligonucleotides ol500 and ol501. The fragment was cloned in frame into the ApaI/KpnI sites of the EGFP-tagging vector p277. For transfection, this construct (pSS312) was linearized at a natural HpaI site within the cdpk1 sequence. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | atatggtaccgaaggtggagaattatttgagc |
Additional information primer 1 | olOB500; CDPK1 for GFP tagging forward |
Sequence Primer 2 | atatgggcccaaatgttttatggtcacaaattttgtg |
Additional information primer 2 | olOB501; CDPK1 for GFP tagging reverse |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |