RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-768
|
||||||||||
Last modified: 23 August 2012, 18:07
*RMgm-768| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 22912579 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | S. Das; R. Tewari; S. Sharma |
| Name Group/Department | Department of Biological Sciences |
| Name Institute | Tata Institute of Fundamental Research |
| City | Mumbai |
| Country | India |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0407700 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0309600 | ||||||||||||||||||||||||
| Gene product | 60S acidic ribosomal protein P2 | ||||||||||||||||||||||||
| Gene product: Alternative name | P2 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The multiple negative attempts to disrupt the p2 gene indicates that this gene is essential for asexual blood stages growth/multiplication. In P. falciparum evidence has been presented for an 'extra-ribosomal' function of P2. Evidence has been presented for export of this protein to the surface of infected erythrocytes. Treatment of infected erythrocytes with antibodies against P2 resulted in cell cycle arrest. the targeting vector for PbP2 (PBANKA_040770) was constructed in pBS-DHFR in which the polylinker sites flank a T. gondii dhfr/ts expression cassette conveying resistance to pyrimethamine. PCR primers PbP2 FP1 (5' CCCCGGGCCCGATATCACAAAATTATATATTAACAC 3'), and PbP2 RP1 (5' GGGGAAGCTT GATAAGCTGCAACGTATTTCATAGCC 3') were used to generate a 748 bp fragment 5' upstream sequence of PbRP2 from wild type genomic DNA, which was inserted into ApaI and HindIII restriction sites upstream of the dhfr/ts cassette of pBS-DHFR. A 492 bp fragment generated with primers PbP2 FP2 (5' CCCCGAATTC GAAGAAGAAGATGATTTAGGATTTTCC 3') and PbP2 RP2 (5' GGGGTCTAGA GAACAACTGTATATACAATGTTCC 3') from the 3' flanking region of PbRP2 was then inserted downstream of the dhfr/ts cassette using EcoRI and XbaI restriction sites. The linear targeting sequence was released from the plasmid using ApaI/XbaI and transfected into schizont. The procedure was repeated at least three times but no drug selected parasites were obtained. For each of the three transfections where PbP2 was used, PF16 and MSP7 K/o was used as a control. In none of these three attempts was PbP2 K/o obtained in second pressure after transfection. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
 Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||