top of page |
Type and details of transgene |
Is the transgene Plasmodium derived |
Transgene: Plasmodium |
Gene Model of Parasite |
PBANKA_0518200
|
Gene Model P. falciparum ortholog |
PF3D7_1034400
|
Gene product | flavoprotein subunit of succinate dehydrogenase |
Gene product: Alternative name | SDHA |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct | Plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
BstXI
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The mutant expresses azamiGFP (AGFP) under control of the 5'- and 3'-UTR region of sdha (flavoprotein subunit of succinate dehydrogenase) and fused the first 60 amino acids of sdha. It is reported that the first 60 amino acids of P. falciparum flavoprotein contains a functional mitochondrial targeting signal The fusion transgene of AGFP and sdha is integrated by single cross-over recombination into the sdha locus resulting in the presence of the transgene and a normal copy of sdha.
Two fragments covering the 5'UTR and the first 60 amino acids (-3229 to +180 bp), and the 3’UTR (1025 bp) of the Pbsdha gene (PBANKA_051820) were amplified with primer pairs 5’UTRB4F/5’UTRB1R and 3’UTRB2F/3’UTRB3R, and P. berghei genomic DNA as template. The Azami Green Fluorescent Protein gene (AGFP) was amplified with the primers AzamiB1F (GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGTGAGTGTGATTAAACC) and AzamiB2R (GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTTGGCCTGACTCGGCA). Each PCR fragment was cloned into pDONRP4-P1R, P1-P2R and P2-P3R vectors by BP clonase reaction (Invitrogen) to generate entry vectors (5UTR/P4P1, AGFP/P1P2 and 3UTR/P2P3). An R4-R3 fragment (Invitrogen) was inserted into the HindIII site of the pBS-DHFR vector to generate an acceptor plasmid (R4R3/pBS-DHFR). The inserts of the entry vectors were transferred to the acceptor plasmid by LR reaction using the Multisite Gateway Three-Fragment Vector Construction Kit (Invitrogen). In the final plasmid (Pbsdha::AGFP), the 5' UTR and the first 60 amino acids of Pbsdha were fused to the AGFP gene. Thus, the expression of the AGFP reporter gene is under the control of the Pbsdha gene promoter. For parasite transfection, the plasmid was digested by BstXI, and the linearized plasmid was integrated into the parasite genome by single crossover homologous recombination. |
Additional remarks selection procedure | |
top of page |
Other details transgene |
top of page |
Promoter |
Gene Model of Parasite |
PBANKA_0518200
|
Gene Model P. falciparum ortholog |
PF3D7_1034400
|
Gene product | flavoprotein subunit of succinate dehydrogenase |
Gene product: Alternative name | SDHA |
Primer information details of the primers used for amplification of the promoter sequence
Primer information details of the primers used for amplification of the promoter sequence
Sequence Primer 1 | GGGGACAACTTTGTATAGAAAAGTTGGTATCATATTCATCATTACATAATTTC |
Additional information primer 1 | 5’UTRB4F |
Sequence Primer 2 | GGGGACTGCTTTTTTGTACAAACTTGGTGCCACTTTATATTTATTTTTTGATAG |
Additional information primer 2 | 5’UTRB1R |
|
|
top of page |
3'-UTR |
Gene Model of Parasite |
PBANKA_0518200
|
Gene product | flavoprotein subunit of succinate dehydrogenase, putative |
Gene product: Alternative name | SDHA |
Primer information details of the primers used for amplification the 3'-UTR sequences
Primer information details of the primers used for amplification the 3'-UTR sequences
Sequence Primer 1 | GGGGACAGCTTTCTTGTACAAAGTGGATTTATCCTTTTTTTTATTCCC |
Additional information primer 1 | 3’UTRB2F |
Sequence Primer 2 | GGGGACAACTTTGTATAATAAAGTTGGTGTATAAATCGTAAAGGGGAAT |
Additional information primer 2 | 3’UTRB3R |
|
|
Insertion/Replacement locus |
Replacement / Insertion | Insertion locus |
Gene Model of Parasite |
PBANKA_0518200
|
Gene product | flavoprotein subunit of succinate dehydrogenase, putative |
Gene product: Alternative name | SDHA |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
|
|
top of page |