Summary

RMgm-753
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0518200; Gene model (P.falciparum): PF3D7_1034400; Gene product: flavoprotein subunit of succinate dehydrogenase (SDHA)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 14 August 2012, 15:57
  *RMgm-753
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22628552
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA. Hino; K. Kita
Name Group/DepartmentDepartment of Biomedical Chemistry
Name InstituteGraduate School of Medicine, The University of Tokyo
CityTokyo
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-753
Principal namePbsdha(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal numbers of gametocytes are produced and male gamete formation (exflagellation) was normal. The conversion rate of female gametes to ookinetes in vitro of Pbsdha(-) was significantly reduced to 17% of wild type parasites.
Fertilization and ookineteThe conversion rate of female gametes to ookinetes in vitro of Pbsdha(-) was significantly reduced to 17% of wild type parasites.
OocystThe conversion rate of female gametes to ookinetes in vitro of Pbsdha(-) was significantly reduced to 17% of wild type parasites.
No oocysts are formed.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of flavoprotein subunit of succinate dehydrogenase (SDHA)

Protein (function)
In other eukaryotes, pyruvate dehydrogenase is localized in mitochondria where it links the glycolysis metabolic pathway to TCA cycle, while it is localized in the apicoplast in P. falciparum. Blood-stage P. falciparum have only a single mitochondrion without crista. Such morphologically immature mitochondrion suggests that, unlike other eukaryotes, the blood-stage P. falciparum relies mainly on cytoplasmic glycolysis for their energy metabolism but not on mitochondrial oxidative phosphorylation. P. falciparum express all TCA cycle enzyme genes and most ones for the electron transport chain (ETC). The genes for TCA cycle are up-regulated at mosquito stages. The gametocytes, precursor cells of gametes possess mitochondria with cristae. These data suggest that mitochondrial energy metabolism may have more crucial roles in insect stages than blood stages. The mitochondrial complex II (succinate-ubiquinone reductase: SQR) oxidizes succinate to produce fumarate as a TCA cycle member enzyme. In the anaerobic electron transfer system, complex II carries out fumarate reduction using quinol as an electron donor (quinol-fumarate reductase; QFR), which is the reverse reaction of SQR. Complex II consists of four subunits, flavoprotein (Fp), iron-sulfur cluster protein (Ip) and two small membrane anchor subunits, cytochrome b large (CybL) and small (CybS) subunits. The Fp with molecular mass of 70 kDa has a flavin adenine dinucleotide (FAD) covalently bound to a highly conserved histidine (His) residue. Fp and Ip form catalytic portion of the complex and this portion act as a succinate dehydrogenase (SDH), catalyzing the oxidation of succinate by water-soluble electron acceptors such as phenazine methosulfate (PMS) in SQR, while it acts as a fumarate reductase (FRD), catalyzing electron transfer from water-soluble electron donors such as reduced methylviologen (MV) to fumarate in QFR. FAD in the Fp receives the reducing equivalents from succinate and then transfers it to quinone by SQR activity where the two small membrane anchor subunits are indispensable (10). Thus, complex II functions as a link between the TCA cycle and the ETC, directly. While complex II has such critical roles in energy metabolisms and Fp and Ip subunits genes are substantially conserved in various organisms, two small membrane anchor subunit genes are diverse. However, evidence for the presence of genes in the Plasmodium genome encoding mitochondrial Complex II subunits SDH3 and SDH4 and ATP synthase subunits a and b.

Phenotype
Phenotype analyses indicate a non-essential function of SDHA for asexual blood stages.
Phenotype analyses indicate an essential function of SDHA for ookinete and/or oocyst formation. Normal numbers of gametocytes are produced and male gamete formation (exflagellation) is normal. The conversion rate of female gametes to ookinetes in vitro of Pbsdha(-) is significantly reduced to 17% of wild type parasites. No oocysts are formed.

Additional information

Other mutants
RMgm-754: A mutant expressing GFP under control of the 5'- and 3'-UTR region of sdha and fused to the first 60 amino acids of sdha


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0518200
Gene Model P. falciparum ortholog PF3D7_1034400
Gene productflavoprotein subunit of succinate dehydrogenase
Gene product: Alternative nameSDHA
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI, BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTwo regions of the Pbsdha gene were amplified by PCR using primer pairs F1-HindIII/R1-HindIII and F2-EcoRI/R2-BamHI, and P. berghei genomic DNA as template. The PCR fragments were digested with respective restriction enzymes and cloned to pBS-DHFR to give a targeting plasmid, pPbsdha(-). The pPbsdha(-) plasmid was digested with ClaI and BamHI, and the plasmid was introduced in P. berghei by electroporation.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAGCTTATGGACCATACACAAAATAAGTACC
Additional information primer 1F1-HindIII
Sequence Primer 2AAGCTTATGCCACTTTATATTTATTTTTTGATAG
Additional information primer 2R1-HindIII
Sequence Primer 3GAATTCGATTTCCCTGAGAGAGATGATCAAAAC
Additional information primer 3F2-EcoRI
Sequence Primer 4GGATCCATTTGAGAATGATATAATGGGAAAAATTAT
Additional information primer 4R2-BamHI
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6