| top of page |
| Type and details of transgene |
| Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
| Transgene name | Flp recombinase of yeast (Flp) |
| top of page |
| Details of the genetic modification |
| Inducable system used | Flp/FRT |
| Additional remarks inducable system |
The mutant expresses the yeast Flp recombinase under the control of the promoter of uis4. The mutant does not contain a selectable marker. This marker (the hdhfr gene) has been removed from the genome by using the Flp/FRT site-specific recombination (SSR) system. Removal of the hdhfr gene has been achieved by transmission of the mutant through mosquitoes, thereby activating expression of the Flp recombinase that resulted in the excision of the hdhfr gene that was flanked by FRT sequences.
|
| Type of plasmid/construct | Plasmid double cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | eef1a |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | The Flp coding sequence was flanked by 1.5 kb of 5' uis4 regulatory sequence and 0.6 kb 3′ trap regulatory sequence and associated with a FRTed hdhfr selectable marker containing its own (eef1a) promoter and terminator sequences. |
| Additional remarks selection procedure | |
| top of page |
| Other details transgene |
| top of page |
| Promoter |
| Gene Model of Parasite |
PBANKA_0501200
|
| Gene Model P. falciparum ortholog |
Not available
|
| Gene product | early transcribed membrane protein up-regulated in infective sporozoites |
| Gene product: Alternative name | |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| top of page |
| 3'-UTR |
| Gene Model of Parasite |
PBANKA_1349800
|
| Gene product | sporozoite surface protein 2 thrombospondin-related anonymous protein |
| Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2 |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| Insertion/Replacement locus |
| Replacement / Insertion | Replacement locus |
| Gene Model of Parasite |
PBANKA_0306000
|
| Gene product | 6-cysteine protein |
| Gene product: Alternative name | 230p |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
| Sequence Primer 1 | ATGGTACCATGA-CATCATTTATAAATCATG |
| Additional information primer 1 | P1 (KpnI); 230p targeting region |
| Sequence Primer 2 | ATACTGCAGTGTGTTTTATTTGGATGTGC |
| Additional information primer 2 | P2 (PstI); 230p targeting region |
| Sequence Primer 3 | TTGGGCCCTTCTCTTGAGCCCGTTAAT |
| Additional information primer 3 | P3 (ApaI); 230p targeting region |
| Sequence Primer 4 | TTGGGCCCTAGGAAATTTGTTTATTTTTATA |
| Additional information primer 4 | P4 (ApaI); 230p targeting region |
|
|
| top of page |