| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_1126900
|
| Gene Model P. falciparum ortholog |
PF3D7_0628200
|
| Gene product | protein kinase PK4 | eukaryotic translation initiation factor 2-alpha kinase |
| Gene product: Alternative name | PK4 |
| top of page |
| Details of the genetic modification |
| Inducable system used | No |
| Additional remarks inducable system |
|
| Type of plasmid/construct used | Plasmid double cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Partial or complete disruption of the gene | Complete |
| Additional remarks partial/complete disruption |
|
| Selectable marker used to select the mutant parasite | hdhfr |
| Promoter of the selectable marker | eef1a |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | Unsuccessful attempts to disrupt the pk4 gene using standard methods of gene disruption (see RMgm-483; RMgm-566; RMgm-738; RMgm-739) indicate an essential role of PK4 during blood stage development.
See RMgm-737 for more information on PK4
Two 500-bpfragments were amplified from the N terminus and 3′ UTR of the PK4 gene. Both fragments were cloned into the pBC_GFP_DHFR plasmid, and the targeting construct was named pBC_PbPK4KO construct(2) |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences 
Primer information: Primers used for amplification of the target sequences
| Sequence Primer 1 | aagcttctcgagatgtataataagggaataaatatttg |
| Additional information primer 1 | PK4GKO-F1 |
| Sequence Primer 2 | tatcaaatcgatataggattaaagctttgaatgtg |
| Additional information primer 2 | PK4GKO-R1 |
| Sequence Primer 3 | cttaaggcggccgccattatggtgtggtggtaatg |
| Additional information primer 3 | PK4GKO-F2 |
| Sequence Primer 4 | ctcgaggcgcgccgagaaaaaataaaaacaagcatata |
| Additional information primer 4 | PK4GKO-R1 |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
| top of page |