RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-738
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1126900; Gene model (P.falciparum): PF3D7_0628200; Gene product: protein kinase PK4 | eukaryotic translation initiation factor 2-alpha kinase (PK4)
PhenotypeNo phenotype has been described
Last modified: 28 April 2012, 22:18
  *RMgm-738
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification Unknown
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22355110
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherM. Zhang; V. Nussenzweig
Name Group/DepartmentDepartment of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1126900
Gene Model P. falciparum ortholog PF3D7_0628200
Gene productprotein kinase PK4 | eukaryotic translation initiation factor 2-alpha kinase
Gene product: Alternative namePK4
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationUnsuccessful attempts to disrupt the pk4 gene using standard methods of gene disruption (see RMgm-483; RMgm-566; RMgm-738; RMgm-739) indicate an essential role of PK4 during blood stage development.

See RMgm-737 for more information on PK4

Two 500-bp fragments of the PK4 N terminus and C terminus were cloned into the pBC_GFP_DHFR plasmid, and the targeting construct was named pBC_PbPK4KO construct (1)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1agtacgctcgagatggaagaggatataaactgtaaag
Additional information primer 1PK4koN_for
Sequence Primer 2tggtacatcgatttctccattttactataatatattattttatg
Additional information primer 2PK4koN_rev
Sequence Primer 3acatgaaggcggccgcaaatttcattgaaagggcaaatgattg
Additional information primer 3PK4koC_for
Sequence Primer 4catgcaaggcgcgcccatatgatcaacttcatttccatt
Additional information primer 4PK4koC_rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren