Summary

RMgm-728
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1348000; Gene model (P.falciparum): PF3D7_1333300; Gene product: transmembrane protein Tmp21 homologue, putative
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
PhenotypeNo phenotype has been described
Last modified: 3 December 2012, 10:06
  *RMgm-728
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23197789
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 676m1cl1 (RMgm-29)
Other information parent line676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherE.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard
Name Group/DepartmentDepartment of Parasitology
Name InstituteBiomedical Primate Research Centre
CityRijswijk
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-728
Principal name1734cl1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation

Protein (function)

Phenotype

Additional information
A pyrimethamine-resistant parasite population was selected after transfection with a construct for targeted gene disruption by double cross-over homologous recombination. The primers of the two target sequences of the gene are provided below.

The genotype of the parasites has not been analysed in detail.
Diagnostic PCR (for correct integration of the construct) and/or Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) have been performed (see below). This analysis provided evidence for correct disruption of the gene indicating that it has no essential function during asexual blood stage development. However, no further analyses on the parasite population/cloned lines have been performed to show absence of transcripts or protein.

The phenotype of the selected parasite population/cloned lines has not been analysed in detail.
No obvious growth defects of the asexual blood stages of the selected parasite populations/cloned lines have been observed.

The gene has been selected for targeted gene disruption based on its presence in a proteome of membranes of infected red blood cells




Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1348000
Gene Model P. falciparum ortholog PF3D7_1333300
Gene producttransmembrane protein Tmp21 homologue, putative
Gene product: Alternative name
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPCR construct
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant was generated by disruption of the gene using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below).

The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction.

The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group.

To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GAACTCGTACTCCTTGGTGACGGGTACCCTCTGTTGCAACATCAGGTAAAAATG
Additional information primer 15743 (AsP718); 5' UTR forward
Sequence Primer 2CATCTACAAGCATCGTCGACCTCCATACTACATTACCCTTGGTCGAAC
Additional information primer 25744; 5' UTR reverse
Sequence Primer 3CCTTCAATTTCGGATCCACTAGCTCGATGGTGCTAGAATGATTTC
Additional information primer 35745; 3' UTR forward
Sequence Primer 4AGGTTGGTCATTGACACTCAGCGGTACCCTCACCTTTTTGAAGATTATGATGAC
Additional information primer 45746 (AsP718); 3' UTR reverse
Sequence Primer 5GAACTCGTACTCCTTGGTGACG
Additional information primer 54661; anchor tag primer
Sequence Primer 6AGGTTGGTCATTGACACTCAGC
Additional information primer 64662: anchor tag primer

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
CCGCGGGTATATGGTAAAGAACCTACTAACACAATAAAATATTTAAATAATGTATTTCCT
ATAAATAAATTTACAGATTTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAAT
GATCAGTTTAAAGGTTTTAAATTCTTTATGACATCATTTATAAATCATGGATCATATCCA
CTAACAATAGAATGTGGTGTAACAAATGGTGGAACTAGTTATAAAAGAGCAATTATTTTA
TTGCATGTTCGAACTGATTTAAAAGATAGACCAGTTTCATTTTGTGATTTTCGAAAAGGA
GAATTATATAATTATTTGAATGCTTATACTGAAGGGGATGTATGCATAATAATTTCCAAA
TCAAATACAAGTTTTGGTTTTAGATGCCCAGTAAATACAAAAAAAATGCCAAAAAATTGT
TTTACGCAAGTATATGAAAAAGGGTATCTAAATGACGCCAATAAAATTAATACTAAAAAT
GTTATTAACTATTCATTTGAAAATCCAGAATATGCGCTAGCTGGTTYTAATTATACATTA
ACAAAATCGTATCAATTTGAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAA
ACGGTTTTAGTCAAATATGTAAATGAAGATGAAATATATGATTATAATGATTTTCCAATG
GTGAATCACAAACCTATTATTGCACATCCAAATAAAACACATCAAGCTTGCATGCCTGCA
GCCCAGCTTAATTCTTTTCGAGCTCTTTATGCTTAAGTTTACAATTTAATATTCATACTT
TAAGTATTTTTTGTAGTATCCTAGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCA
GTAATATTTTCATCCACTGAAATACCATTAAATTTTCAAAAAAATACTATGCATATAATG
TTATACATATAAACATAAAACGCCATGTAAATCAAAAAATATATAAAAATATGTATAAAA
ATAAATATGCACTAAATATAAGCTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACT
AGTCGTAATTATTTATATTTCTATGTTATAAAAAAATCCTCATATAATAATATAATTAAT
ATATGTAATGTTTTTTTTATTTTATAATTTTAATATAAAATAATATGTAAATTAATTCAA
AAAATAAATATAATTGTTGTGAAACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTT
AAATTTATTTTAATATTTCCTAAAATATATATACTTTGTGTATAAATATATAAAAATATA
TATTTGCTTATAAATAAATAAAAAATTTTATAAAACATAGGGGGATCTATGAGTAAAGGA
GAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGG
CACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTT
AAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTC
GGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTC
AAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGG
AACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAG
TTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAAC
TATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAAC
TTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAA
AATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAA
TCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTA
ACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAG
TCGACCTGCAGGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAG
AAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAG
GCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAG
GTGAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAA
CGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTC
TTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATT
TATAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTT
TCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAA
ATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTC
ACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGT
GACAAAACAATTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTG
GCCCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGC
AATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGA
ATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTT
GAAGAAGAGCTGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTA
CCAACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAAT
TTACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCA
AAACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCT
ATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTT
TTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGC
GAATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACC
AACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAA
GACGAACACTTCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAG
GTGGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGC
GTGGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAG
CACGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACC
GCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGA
AAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATC
GCCGTGTAATTCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTA
TTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCAT
GTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACAC
ATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGAC
CATATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTA
TTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATA
GTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTG
AAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCG
AGCTCGAATTCTCTTGAGCCCGTTAATGAAATAGATACAATTCATTCATGTTATATACAT
CTAGAACATAATCTGAATATGGTTCAAGTTAAATGTCCAAAAATTATAAAAAGTGATGAT
ATTTTTGATGGTAATACCATAATAGACACCAAGGTAACATCACGAAGTAGTCAACAAAAT
AATTTTTATTTAGAAAATACAGATGTTGAACCAGAAGAAATAGAGAAATATAAAAATATA
GAATACATACCAGAAAACGATGAAGTAATGCATCTAGACAAAAAAGAAAAGCTAGATGAT
ATATTACCAGGTGTTATCATATTAGATAAAAATAAAATGTTCAAAGAAAAAGGACATTTC
ACTTTTGTTACTCCATTAATTGTAGAAAAGGTATTAATATTAAAAATATATTGTGATAAT
ACTAAAACAATAATTAATAATATGAAAGGGAAAAAAGGTATTACAGTAATAAGGATTTCT
CAAAATACAACAAAAAATAAATTTTATGGATGTGACTTTTCAGGTAATTCTAAAAAAACA
TTTTACTATTCCAATGTTTATGATTTAGAAAAAAAAAATGAGTTTTGTGAAATAGAATTA
AAAGAAAATATAGTAGTTAGCTTAAATTGTCCAACTGGTAAAATTAATCCAAAAAATTGT
TTTAGAAATGTATATATAAAAAGTAATATGAATGAACAAACAACCGAAAATATAGAAAAT
ATATTTAACGAAATAAAAGTTATAGATGCAGATTATTTTATAAATAATTCATCAACCTTT
TTGATGATTTCCAAAATTACAAAAAAAGAGTTTGATTTTTATTGTACATGTGAAGATTAT
AAAACCAAAAATATAGGAACAATATATATTAAAAATTATGAATATCTAGATTCAAAACCT
AAATATAAAAATAAACAAATTTCCTATATAGATGTAGTTCCATACCCGCGGGGAAAGGGC
G
Restriction sites to linearize plasmid ApaI, SacII
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4