Summary

RMgm-718
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1229000; Gene model (P.falciparum): PF3D7_0801000; Gene product: Plasmodium exported protein (PHISTc), unknown function (PHIST)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1 (AMA-1)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage;
Last modified: 30 June 2016, 12:56
  *RMgm-718
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 27022937
Reference 2 (PMID number) : 23197789
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 1037m1f1mocl1 (RMgm-32)
Other information parent lineP. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192).
The mutant parasite was generated by
Name PI/ResearcherC.K. Moreira; E.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard; T.J. Templeton
Name Group/DepartmentDepartment of Parasitology
Name InstituteBiomedical Primate Research Centre
CityRijswijk
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-718
Principal name1620cl1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageTo describe the development of the asexual blood stages of PBANKA_1229000 KO lines we determined the course of infection in Swiss Webster and C57Bl/6 mice following either inoculation with sporozoites or intraerythrocytic stages. An apparent trend (but not statistically different) towards long survival was observed in Swiss Webster mice or C57Bl/6 mice that were intravenously (i.v.) injected with 10(4) and 10(5) schizonts (Swiss Webster mice) or 10(3) or 10(4) mixed asexual stages (C57Bl/6 mice) of PBANKA_1229000 KO parasites. When we monitored the survival of mice after i.v. inoculation of 1,000 P. berghei ANKA wt or PBANKA_1229000 KO sporozoites, we observed a longer survival time of mice infected with PBANKA_122900 KO than those infected with wt parasites, which is in support of the above mild growth delay of asexual blood stages. We did not detect differences in reticulocyte versus normocyte preference or a lower production of merozoites per schizonts
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PBANKA_1229000 (PHIST protein)

Protein (function)
In the P. berghei genome sequence  3 phist genes (namely, PBANKA_1145400, PBANKA_1229000 and PBANKA_0700800) were identified via BLAST analysis using PHIST domains and pssm profiles as queries. This result differs from the single P. berghei phist gene described in the original annotation. Orthologs of PBANKA_1145400 and PBANKA_1229000 were identified in the genome nucleotide sequence databases for other rodent malaria parasites; namely, P. yoelii (PY00289 and PY01786, respectively) and P. chabaudi (PCAS_1144900 and PCAS_1229700, respectively). Additional phist genes were not identified in rodent malaria parasites. BLAST analyses using the PHIST domain as queries, identify as reciprocal best hits PBANKA_1229000, the P. vivax PHIST protein PvPHIST/CVC-8195 (PVX_093680), and P. falciparum PF3D7_0801000. This indicates possible orthologous (vertically inherited) relationships and is supported by the observed synteny of adjacent genes, including the ookinete-expressed gene warp, together composing a locus which is conserved across the Plasmodium genus. PBANKA_1229000 is internally localized in the P. berghei genome, but the locus appears to be sub-telomeric in species other than rodent malaria parasites.
The P. berghei PHIST proteins PBANKA_1145400 and PBANKA_1229000 possess similar features to P. falciparum PHIST proteins; namely, signal peptides and PEXEL/HT trafficking motifs; and single PHIST domains, which are divergent in aa sequence with respect to each other. Within the single predicted ORF of PBANKA_0700800 we were unable to identify a signal peptide sequence, and there were no attractive upstream ORFs suggestive of an erroneous gene model. We thus propose that PBANKA_0700800 is a pseudogene. The remaining P. berghei phist genes possess the typical 2-exon gene structure, in which the signal peptide is encoded on the first exon and the PEXEL/HT motif is located within the second exon.


Phenotype
To describe the development of the asexual blood stages of PBANKA_1229000 KO lines we determined the course of infection in Swiss Webster and C57Bl/6 mice following either inoculation with sporozoites or intraerythrocytic stages. An apparent trend (but not statistically different) towards long survival was observed in Swiss Webster mice or C57Bl/6 mice that were intravenously (i.v.) injected with 10(4) and 10(5) schizonts (Swiss Webster mice) or 10(3) or 10(4) mixed asexual stages (C57Bl/6 mice) of PBANKA_1229000 KO parasites. When we monitored the survival of mice after i.v. inoculation of 1,000 P. berghei ANKA wt or PBANKA_1229000 KO sporozoites, we observed a longer survival time of mice infected with PBANKA_122900 KO than those infected with wt parasites, which is in support of the above mild growth delay of asexual blood stages. We did not detect differences in reticulocyte versus normocyte preference or a lower production of merozoites per schizonts

No differences were observed in gametocyte-, oocyst-  and sporozoite-production and inhepatocyte invasion and liver stage development when compared to wild type parasites.

Additional information
RT-PCR was performed using cDNA that was prepared from synchronized asexual stages, gametocytes and mosquito stage parasites. PBANKA_1145400 and PBANKA_1229000 are predominantly transcribed in mature schizont stage parasites, and the transcript levels in schizonts were comparable to the levels of ama1 transcripts (PBANKA_0915000), which was used as a positive marker for schizont stage transcription in addition to the control housekeeping gene, hsp70 (PBANKA_0914410). Low expression of PBANKA_114540 was observed in gametocytes and no transcripts were detected in mosquito stages. Lack of detectable PBANKA_0700800 transcripts supports the above annotation as a pseudogene.

Immunolocalization studies using affinity purified rabbit polyclonal anti-sera against PBANKA_1145400 and PBANKA_1229000 revealed that both proteins are exported to the erythrocyte cytoplasm and observed throughout the intraerythrocytic life cycle. In early asexual stages, both proteins exhibited a punctate, vesicle-like localization in the erythrocyte cytoplasm while in more mature stages the protein distribution appeared more diffuse. Immunofluorescence analysis also suggests that PBANKA_1145400 and PBANKA_1229000 associate with vesicle-like structures, or aggregations, in the erythrocyte cytoplasm. In addition, the proteins co-localize, suggesting they share a common export system, or aggregation, in the rodent malaria parasites. Staining of non-permeabilized cells was negative, indicating that PBANKA_1145400 and PBANKA_1229000 are not exposed on the surface of the infected erythrocyte (data not shown). We did not observe association of either PHIST protein with the erythrocyte membrane.

Phenotype analyses of the blood stages of a mutant expressing an mCherry-tagged version of this protein (RMgm-708) by fluorescence microscopy did not reveal any fluorescence. However, IFA analysis using antibodies against mCherry and against the protein showed export into the host erythrocyte with a punctate localisation pattern. ((Moreira C. et al., 2016; Plos One 11(3):e0152510)).


Other mutants
RMgm-708: mutant expressing an mCherry-tagged version of PBANKA_1229000


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1229000
Gene Model P. falciparum ortholog PF3D7_0801000
Gene productPlasmodium exported protein (PHISTc), unknown function
Gene product: Alternative namePHIST
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Click to view information
Click to hide information
GGCATTACTAAATGATCAGTACTACCATCTAAAATTGATTAAAAATATATGGTTTTATTT
TAATCGTGCTTTACTTTGTGCTTTCATTGTTTGATTTCTTTTTTTACATAAAGTAATTTA
ATAAATATCATGATAATAGGATCATAGTTGTAGTTTCACATATAGTATATATAATACAGT
TGTATTATAAAAAATATTTATTAAATCTAACTTTTTAATAATATATAAAAATTTATTATA
TGATCATAAAATTGTTAACATTTTATTAAGAGCAAATAATTTATAAGTGTAAAAAAGGTA
ATTATAAAAATTTTTATTATTAAGAAAAATAACAAAATAATAATAAATTTTTTATTTGTT
ATATTTTTTTTATTTTGTTATTTTATCAGAAATATATTCTATATTGAAAGAAGAAGCTTC
GACTATATTTCTATATATTATTTGATACTTTATTTTTTTTTATTTCTAAGGTTTTATTAT
CTCGTTATAAATTATTATTTTATTGTAGGAAGCATAGGCTTAAAATATTACATTTTATAT
TATGAAAATAATATTTTTTTTATATAAAAAAGAAATAATTAGTACTTTGGTTTATTATTA
TTAGAACCGCATATTTGCAATATATGTATGATCAATATTTCATACTTAAAAAATAGAGAT
AAAGTCGTAATATTATAATATTTTTAAATATTTTTGTATTGCCCCCAAAATAAATATAAT
ACATATATTTTTATTATTATTTTTTAGAAAAAATATAAAAAATGTATCTAAGGCTTGAAA
AATAGATCAGGAGGTCGACGATGCTTGTAGATGAGTTAAGCTTAATTCTTTTCGAGCTCT
TTATGCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGTAGTATCCTAGAT
ATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATCCACTGAAATACC
ATTAAATTTTCAAAAAAATACTATGCATATAATGTTATACATATAAACATAAAACGCCAT
GTAAATCAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTAAATATAAGCTAA
TTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATTATTTATATTTCTATGT
TATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTTTTTTATTTTATA
ATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAATTGTTGTGAAACA
AAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAATATTTCCTAAAAT
ATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAATAAATAAAAATT
TTATAAAAATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCG
GCAAGAACGGGGACCTGCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAA
TGACCACAACCTCTTCAGTAGAAGGTAAACAGAATCTGGTGATTATGGGTAAGAAGACCT
GGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGGGTAGAATTAATTTAGTTCTCAGCA
GAGAACTCAAGGAACCTCCACAAGGTGCACATTTTCTTTCCAGAAGTCTAGATGATGCCT
TAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTTGGTG
GCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAA
GGATCATGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATA
AACTTCTGCCAGAATACCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGT
ACAAATTTGAAGTATATGAGAAGAATGATTAATGTTCGTTTTTCTTATTTATATATTTAT
ACCAATTGATTGTATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGT
GCATGCACATGCATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAA
AAAACTTTACACACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCC
TATGAATTTATGACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACA
ATAAGACAAAATTATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCA
ATGATTCATAAATAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTA
AATAAAAAAAGTTGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTC
AATTTCGGATCCACTAGGAGAGATGTATAATATTGATGAGCGTAAAATAGAAGAACCAAT
GTGGTTAGGTTTGAAAAGCTCATATAAACCTACTCCAAGAAAACCATATGCATCAAACTT
TTCTGATATGGAAACATTCCCACGAGAAAATTATTCAAGAAATAAACATGAGGCATTTGA
TAGATTCGATTCACACAATATGCCAAGAGGTCATAGTACTAAATACCCTACACGCACATC
TTCAGAATTTCATAATCCAATGAATAGATATAATTCTAGGGGCACTTCAAACTCAGGAAG
TATATTAAATTCAATGAAAAGTTTACGAGGAAATGATTCTCATAGACTAGATAATGGACA
AAATTATATGAGTGAACCAATATCTACAACATCCATGGGAAACCATAAATTATATTTTGG
AAGTAAAAATACTCAAGAAACTATAAGTACATCATTCAAATCTAAATCAAATGATTATAA
GGGTCTTGATCAACAGAATAAAGCTAGTAATTATAATTCAGATACAGATGCAGTTATAGA
TAGTAAAGAAGTAAGTGAAACTAATTTTAGTCCAAGAAAGTCACCAGATGCTCAAATCAA
AGAAATGAATGATCATATAAATGAAAAAATTGACATGTTAGATGAAAATGCAACTCCAGA
TGTATTTCGTAATATTTGGACAATTTTCATTTCTGCTGAAACTAAAAAATTGATGATGAC
TCAAGAATATGTATTACAATATTCTATATATCTACAAAAACGAAATAAATTATATCCAGA
AATGCGCACGGCGGCATGGTGGAAAGTACATTATTCTATGATTAATAAATTTATAAAGCG
TGAAAAAGAAGAGGTTTCTGAATTAAAAGAATTATTAAAATCATCTACTAATACATATTC
TAATTTCGTCACGTTTATTAGAAATAAAATGG
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant was generated by disruption of the gene using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below).

The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction.

The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group.

To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GAACTCGTACTCCTTGGTGACGGGTACCGGCATTACTAAATGATCAGTACTACC
Additional information primer 15412 (AsP718); 5' UTR forward
Sequence Primer 2CATCTACAAGCATCGTCGACCTCTGATCTATTTTTCAAGCCTTAGATAC
Additional information primer 25413; 5' UTR reverse
Sequence Primer 3CCTTCAATTTCGGATCCACTAGGGAGAGATGTATAATATTGATGAGCG
Additional information primer 35414; 3' UTR forward
Sequence Primer 4AGGTTGGTCATTGACACTCAGCGGTACCCCATTTTATTTCTAATAAACGTGACG
Additional information primer 45415 (AsP718); 3' UTR reverse
Sequence Primer 5GAACTCGTACTCCTTGGTGACG
Additional information primer 54661; anchor tag primer
Sequence Primer 6AGGTTGGTCATTGACACTCAGC
Additional information primer 64662: anchor tag primer

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTT
CTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCTGC
TCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGA
CGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGC
ATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATA
CGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT
ATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCT
GTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCA
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCC
GAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCC
CGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTG
GTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATC
GGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATG
CCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGC
TCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT
CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATG
ACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATC
AAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAG
GTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTA
GGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA
CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTG
GAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACG
CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG
CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAA
AACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATG
TTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCT
GATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG
CTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
ATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
CCGCGGGTATATGGTAAAGAACCTACTAACACAATAAAATATTTAAATAATGTATTTCCT
ATAAATAAATTTACAGATTTATTTTTTAATACAAAAGATATAGATATACCAGAAATAAAT
GATCAGTTTAAAGGTTTTAAATTCTTTATGACATCATTTATAAATCATGGATCATATCCA
CTAACAATAGAATGTGGTGTAACAAATGGTGGAACTAGTTATAAAAGAGCAATTATTTTA
TTGCATGTTCGAACTGATTTAAAAGATAGACCAGTTTCATTTTGTGATTTTCGAAAAGGA
GAATTATATAATTATTTGAATGCTTATACTGAAGGGGATGTATGCATAATAATTTCCAAA
TCAAATACAAGTTTTGGTTTTAGATGCCCAGTAAATACAAAAAAAATGCCAAAAAATTGT
TTTACGCAAGTATATGAAAAAGGGTATCTAAATGACGCCAATAAAATTAATACTAAAAAT
GTTATTAACTATTCATTTGAAAATCCAGAATATGCGCTAGCTGGTTYTAATTATACATTA
ACAAAATCGTATCAATTTGAATGTCATTGTGTAGATAAAGAAACAGAACAAATTGTAAAA
ACGGTTTTAGTCAAATATGTAAATGAAGATGAAATATATGATTATAATGATTTTCCAATG
GTGAATCACAAACCTATTATTGCACATCCAAATAAAACACATCAAGCTTGCATGCCTGCA
GGAATTCGATATCGAATTCCCATGGAACCAAAATAACATATTAATGAATTTTCTTTTATT
GTGAAAATGTTCTTATTTGTTTTAAAAAATCAAAGTAAATTTAATTCCTTTAATTGTGCT
AAATATTGTGTTTGTATAACTATAATGACATTTCCTATGCTTTTTTAATATTATATATAA
TTTTTTGTGTTTTTTCAAAAAAAACGTGTATTTGTTTTTATTTGAGTGTACAATTTGCAT
AGTGAGTTTAAAGTGTTTGAAAATTATTTAATTTATAATTTTCATAAAACGTTTAATCAT
TTATCAAAATTGCGGTTGCAATATAGACAGAAAATATTAACTTAATTTTCATTGTTTTGT
AAAACATTTTCATTATTTTTTTTAACAAAATTAAAGTAAATGAGATGGTAAATTATTTTA
ATTATAACCATTTGTTTAATTTTTTTTATTTTATTACTATTATTTTTTTTCTTTTGTGCT
GCGCAATTAAAAAGAGAATTAAGGGTGCACCAATATATTTAAGCAATCTTTTGCGACACA
CAAGAAAAAATATAACATCAACATATTTAAAATAATGGAAATTTTTTAATAATTTATTCT
ATATATATTTAATATATGTAAAAAAACTAATATTGTAATATAATTAAATAAAACTTGAAA
TTGATATAATATGTATATATATTGCATGTTTAGCTTTAAATAATATTTAAGTATTGATTT
TCTTTACACACAAAAACATTTGCCTTTTTATGTGAGGATTATTGTTTCTTTATTTATATT
GCTATGAATTTATTCTTAGTATAAATTTATTTTTTTTCGGCTTTGAAAATAATTTTATAT
ATATAAAAAGAAAAAATATGGAAAATAAAATTCATAAATCATATTTGACACATTTCAATT
TTTTTTTCTTATTTCACAGCTAGCCATATAATAATATATATGTGTCTATGGGTTCAAATA
GCTTAATTTCAATGTGCGTGATTTTTTTTTATAAAAAAACTAATTTTATGTTTGGTTATG
CATGCAACTGTTATAAAATAAAAATTGTAAAATTTGTTTTTTTGTACACATATTTGTACT
TTTTTTAATGCACATGAAAAAAGAAAGGAAAAAAAAGGGGGAAAAAAAAGGAAAAAAAAA
GGGAAAAAAGGGAAAAAACGTACATCTACGCATTGTTATTTAGCAATAAAATAGAGAACA
AATCTATAAATATATAATGTGTACAACAAATTAATTTAATTTATATTTTTACTGTAATTT
CATAATAATTTTCATTTTTACATTTTAATGTTTTTTTAATTGGAATATAATTCAAAATGA
TTTTGACACATTTTACTTATAGAAGAAGGCTATATAATTATATAAGTGTGTATATATAAG
TATTGTATGGTAATTGTTTTATAAATTAAATTTTTAAAAAACATTATTCTATTTTATAAT
TTGTAAATTAAAAATATTAATAAAATAAAACGATATAAAAGGATCCATGAGTAAAGGAGA
AGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCA
CAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAA
ATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGG
TTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAA
GAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAA
CTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTT
AAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTA
TAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTT
CAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAA
TACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATC
TGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAAC
AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTC
GACCTGCAGGCATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAA
AGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGC
TATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGT
GAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACG
ATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTT
TATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTA
TAATGAACGTGAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTC
CAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAAT
TATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCAC
ATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGA
CAAAACAATTGCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGC
CCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAA
TCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAAT
GTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGA
AGAAGAGCTGTTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACC
AACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTT
ACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAA
ACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTAT
TCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTT
TGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGA
ATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAA
CGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGA
CGAACACTTCTTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGT
GGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGT
GGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCA
CGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGC
GAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAA
ACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGC
CGTGTAATTCTAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATT
TATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGT
AAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACAT
AAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCA
TATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATT
ATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGT
TGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAA
AAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTACCGAG
CTCGAATTCTCTTGAGCCCGTTAATGAAATAGATACAATTCATTCATGTTATATACATCT
AGAACATAATCTGAATATGGTTCAAGTTAAATGTCCAAAAATTATAAAAAGTGATGATAT
TTTTGATGGTAATACCATAATAGACACCAAGGTAACATCACGAAGTAGTCAACAAAATAA
TTTTTATTTAGAAAATACAGATGTTGAACCAGAAGAAATAGAGAAATATAAAAATATAGA
ATACATACCAGAAAACGATGAAGTAATGCATCTAGACAAAAAAGAAAAGCTAGATGATAT
ATTACCAGGTGTTATCATATTAGATAAAAATAAAATGTTCAAAGAAAAAGGACATTTCAC
TTTTGTTACTCCATTAATTGTAGAAAAGGTATTAATATTAAAAATATATTGTGATAATAC
TAAAACAATAATTAATAATATGAAAGGGAAAAAAGGTATTACAGTAATAAGGATTTCTCA
AAATACAACAAAAAATAAATTTTATGGATGTGACTTTTCAGGTAATTCTAAAAAAACATT
TTACTATTCCAATGTTTATGATTTAGAAAAAAAAAATGAGTTTTGTGAAATAGAATTAAA
AGAAAATATAGTAGTTAGCTTAAATTGTCCAACTGGTAAAATTAATCCAAAAAATTGTTT
TAGAAATGTATATATAAAAAGTAATATGAATGAACAAACAACCGAAAATATAGAAAATAT
ATTTAACGAAATAAAAGTTATAGATGCAGATTATTTTATAAATAATTCATCAACCTTTTT
GATGATTTCCAAAATTACAAAAAAAGAGTTTGATTTTTATTGTACATGTGAAGATTATAA
AACCAAAAATATAGGAACAATATATATTAAAAATTATGAATATCTAGATTCAAAACCTAA
ATATAAAAATAAACAAATTTCCTATATAGATGTAGTTCCATACCCGCGGGGAAAGGGCG
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerama-1
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative nameAMA-1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4