SummaryRMgm-718
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 27022937 Reference 2 (PMID number) : 23197789 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 1037m1f1mocl1 (RMgm-32) |
Other information parent line | P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | C.K. Moreira; E.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard; T.J. Templeton |
Name Group/Department | Department of Parasitology |
Name Institute | Biomedical Primate Research Centre |
City | Rijswijk |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-718 |
Principal name | 1620cl1 |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | To describe the development of the asexual blood stages of PBANKA_1229000 KO lines we determined the course of infection in Swiss Webster and C57Bl/6 mice following either inoculation with sporozoites or intraerythrocytic stages. An apparent trend (but not statistically different) towards long survival was observed in Swiss Webster mice or C57Bl/6 mice that were intravenously (i.v.) injected with 10(4) and 10(5) schizonts (Swiss Webster mice) or 10(3) or 10(4) mixed asexual stages (C57Bl/6 mice) of PBANKA_1229000 KO parasites. When we monitored the survival of mice after i.v. inoculation of 1,000 P. berghei ANKA wt or PBANKA_1229000 KO sporozoites, we observed a longer survival time of mice infected with PBANKA_122900 KO than those infected with wt parasites, which is in support of the above mild growth delay of asexual blood stages. We did not detect differences in reticulocyte versus normocyte preference or a lower production of merozoites per schizonts |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Not different from wild type |
Additional remarks phenotype | Mutant/mutation No differences were observed in gametocyte-, oocyst- and sporozoite-production and inhepatocyte invasion and liver stage development when compared to wild type parasites. Immunolocalization studies using affinity purified rabbit polyclonal anti-sera against PBANKA_1145400 and PBANKA_1229000 revealed that both proteins are exported to the erythrocyte cytoplasm and observed throughout the intraerythrocytic life cycle. In early asexual stages, both proteins exhibited a punctate, vesicle-like localization in the erythrocyte cytoplasm while in more mature stages the protein distribution appeared more diffuse. Immunofluorescence analysis also suggests that PBANKA_1145400 and PBANKA_1229000 associate with vesicle-like structures, or aggregations, in the erythrocyte cytoplasm. In addition, the proteins co-localize, suggesting they share a common export system, or aggregation, in the rodent malaria parasites. Staining of non-permeabilized cells was negative, indicating that PBANKA_1145400 and PBANKA_1229000 are not exposed on the surface of the infected erythrocyte (data not shown). We did not observe association of either PHIST protein with the erythrocyte membrane. Phenotype analyses of the blood stages of a mutant expressing an mCherry-tagged version of this protein (RMgm-708) by fluorescence microscopy did not reveal any fluorescence. However, IFA analysis using antibodies against mCherry and against the protein showed export into the host erythrocyte with a punctate localisation pattern. ((Moreira C. et al., 2016; Plos One 11(3):e0152510)).
|
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1229000 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0801000 | ||||||||||||||||||||||||
Gene product | Plasmodium exported protein (PHISTc), unknown function | ||||||||||||||||||||||||
Gene product: Alternative name | PHIST | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
GGCATTACTAAATGATCAGTACTACCATCTAAAATTGATTAAAAATATATGGTTTTATTT
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | The mutant was generated by disruption of the gene using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group. To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV) | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence |
AATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
| ||||||||||||||||||
Restriction sites to linearize plasmid | KspI (SacII) | ||||||||||||||||||
Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
Promoter of the selectable marker | ama-1 | ||||||||||||||||||
Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | The GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration | ||||||||||||||||||
Additional remarks selection procedure | This reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence | ||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0915000 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1133400 | ||||||||||||||||||
Gene product | apical membrane antigen 1 | ||||||||||||||||||
Gene product: Alternative name | AMA-1 | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |