Summary

RMgm-716
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c/d-type unit))
Phenotype Asexual bloodstage;
Last modified: 20 February 2012, 15:49
  *RMgm-716
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Not published (yet)
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei K173
Name parent line/clone P. berghei K173 cl1
Other information parent lineThe K173cl1 is a cloned laboratory line of the K173 strain of P. berghei that lacks gametocyte production and sequestration of schizonts. The absence gametocyte production and schizont-sequestration can most likely be explained by the laboratory history of this line; it has been kept for more than 20 years in mice by mechanical blood passage; its chromosomes are reduced in size as a result of the loss of subtelomeric genes and repeat elements (PubMed: PMID: 2674047; 2649389). This line has frequently been used to study P. berghei ECM (PubMed: PMID: 2230643; 9806067).
The mutant parasite was generated by
Name PI/ResearcherB. Franke-Fayard; C.J. Janse
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-716
Principal name1272m1cl1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageGFP-Luciferase expression in mature schizonts and young ring forms.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses GFP-luciferase under the control of the schizont-specific ama-1 promoter. The gfp-luc gene has been integrated into the c/d-ssu-rRNA unit by double cross-over homologous recombination. The mutant has been selected by flow sorting (FACS) and does not contain a drug-selectable marker.

Phenotype
GFP-Luciferase is expressed in maturing schizonts and is still present in young ring forms (0-4 hours after invasion), carried over from the schizonts.

The mutant is generated into the K173cl1 parent line of P. berghei. This line is a cloned laboratory line of the K173 strain of P. berghei  that lacks gametocyte production and sequestration of schizonts. The absence gametocyte production and schizont-sequestration can most likely be explained by the laboratory history of this line; it has been kept for more than 20 years in mice by mechanical blood passage; its chromosomes are reduced in size as a result of the loss of subtelomeric genes and repeat elements (PubMed: PMID: 2674047; 2649389). This line has frequently been used to study P. berghei ECM (PubMed: PMID: 2230643; 9806067).

However, this specific clone shows a strongly reduced capacity to induce cerebral complications in C57Bl/6 mice

Additional information
 RMgm-380:  This mutant, generated into the K173cl1 parent line of P. berghei, expresses Luciferase under the control of the constitutive eef1a promoter.
RMgm-375: An independent  mutant, generated into the K173cl1 parent line of P. berghei, expressing GFP-Luciferase under the control of the constitutive ama-1 promoter. The gfp-luc gene has been integrated into the c/d-ssu-rRNA unit by single cross-over homologous recombination and in this mutant multiple copies (2-3) of the GFP-Luciferase gene are integrated. The mutant contains the tgdhfr selectable marker.


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
CGTGATATTCTTCGAAGGTGGACTAACTATAGCGTTTTCGAAGGTATGTTGCATAATCAA
ATTGGTTTACCCTTTGTTTTTTTGTAGCATATTCTTTTATTTCGTTGGGTTTTTTCCCTA
GTAAGGATGTATCTGCTTTATTTAATGCTTCTTAGAGGAACGATGTGTGTCTAACACAAG
GAAGTTTAAGGCAACAACAGGTCTGTGATGTCCTTAGATATACTAGGCTGCACGCGTGCT
ACACTGATATGTAAAACGAGTATTTAAAATTATATCTGTATGGTAGATAATTTAATTTCT
ACGTATTATCAGCATATACTTTTCCTACACTGAAATAGTGAAGGTAATCTTTATCAATAC
ATATCGTGATGGGGATAGATTATTGCAATTATTAATCTTGAACGAGGAATGCCTAGTAAG
CATGATTCATCAGATTGTGCTGACTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTC
CTACCGATTGAAAGATATGATGAATTGTTTGGACAAGAAAATAGAAATTTTATTTTTATT
TTTTTTGGAAGGACCGTAAATCCTATCTTTTAAAGGAAGGAGAAGTCGTAACAAGGTTTC
CGTAGGCCGCGGGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGG
CGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGA
AGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCT
GATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCT
CAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGC
TGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGT
CTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAA
GGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGAC
GTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAAT
ACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTG
AAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGC
ATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGA
TCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGA
GAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGG
CGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTC
TCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGAC
AGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACT
TCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCA
TGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCG
TGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACT
ACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGG
ACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGG
TGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTAT
CGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGC
TGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATAT
ACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTT
TGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCC
CGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTT
GCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAAC
TCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGT
GTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCT
GCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGA
CTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCAC
ACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCATTG
AGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGT
CGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC
TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCG
GAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCC
TTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGC
CTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAG
CGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCA
TTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAAT
TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG
TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA
TTACGCCAAGCTTCCGCGGCCTGGTTGATCTTGCCAGTAGTCATATGCTTGTCTCAAAGA
TTAAGCCATGCAAGTGAAAGTATATGCACATTTATTGCAGAAACTGCGAACGGCTCATTA
AAACAGTTATAATCTACTTGACATTTTATTATAAGGATAACTACGGAAAAGCTGTAGCTA
ATACTTGTTAAGTACTTTTACTCCCCGGAGTAATTGTATGTATTTGTTAAGACCCCTAAG
AAAAAATGATATTAAAGGAATTATAACAAAGAAGCAACACATAATATAATTATTCAGTGT
GTATCAATCGAGTTTCTGACCTATCAGCTTTTGATGTTAGGGTATTGACCTAACATGGCT
TTGACGGGTAACGGGGAATTAGAGTTCGATTCCGGAGAGGGAGCCTGAGAAATAGCTACC
ACATCTAAGGAAGGCAGCAGGCGCGTAAATTACCCAATTCTAAATAAGAGAGGTAGTGAC
AAGAAATAACAATATAAGGCCAAATTTTGGTTTTATAATTGGAATGATGGGAATTTAAAA
CCTTCCCAAAAATCAATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCTGCAGGAATTCGAT
ATCGAATTCCCATGGAACCAAAATAACATATTAATGAATTTTCTTTTATTGTGAAAATGT
TCTTATTTGTTTTAAAAAATCAAAGTAAATTTAATTCCTTTAATTGTGCTAAATATTGTG
TTTGTATAACTATAATGACATTTCCTATGCTTTTTTAATATTATATATAATTTTTTGTGT
TTTTTCAAAAAAAACGTGTATTTGTTTTTATTTGAGTGTACAATTTGCATAGTGAGTTTA
AAGTGTTTGAAAATTATTTAATTTATAATTTTCATAAAACGTTTAATCATTTATCAAAAT
TGCGGTTGCAATATAGACAGAAAATATTAACTTAATTTTCATTGTTTTGTAAAACATTTT
CATTATTTTTTTTAACAAAATTAAAGTAAATGAGATGGTAAATTATTTTAATTATAACCA
TTTGTTTAATTTTTTTTATTTTATTACTATTATTTTTTTTCTTTTGTGCTGCGCAATTAA
AAAGAGAATTAAGGGTGCACCAATATATTTAAGCAATCTTTTGCGACACACAAGAAAAAA
TATAACATCAACATATTTAAAATAATGGAAATTTTTTAATAATTTATTCTATATATATTT
AATATATGTAAAAAAACTAATATTGTAATATAATTAAATAAAACTTGAAATTGATATAAT
ATGTATATATATTGCATGTTTAGCTTTAAATAATATTTAAGTATTGATTTTCTTTACACA
CAAAAACATTTGCCTTTTTATGTGAGGATTATTGTTTCTTTATTTATATTGCTATGAATT
TATTCTTAGTATAAATTTATTTTTTTTCGGCTTTGAAAATAATTTTATATATATAAAAAG
AAAAAATATGGAAAATAAAATTCATAAATCATATTTGACACATTTCAATTTTTTTTTCTT
ATTTCACAGCTAGCCATATAATAATATATATGTGTCTATGGGTTCAAATAGCTTAATTTC
AATGTGCGTGATTTTTTTTTATAAAAAAACTAATTTTATGTTTGGTTATGCATGCAACTG
TTATAAAATAAAAATTGTAAAATTTGTTTTTTTGTACACATATTTGTACTTTTTTTAATG
CACATGAAAAAAGAAAGGAAAAAAAAGGGGGAAAAAAAAGGAAAAAAAAAGGGAAAAAAG
GGAAAAAACGTACATCTACGCATTGTTATTTAGCAATAAAATAGAGAACAAATCTATAAA
TATATAATGTGTACAACAAATTAATTTAATTTATATTTTTACTGTAATTTCATAATAATT
TTCATTTTTACATTTTAATGTTTTTTTAATTGGAATATAATTCAAAATGATTTTGACACA
TTTTACTTATAGAAGAAGGCTATATAATTATATAAGTGTGTATATATAAGTATTGTATGG
TAATTGTTTTATAAATTAAATTTTTAAAAAACATTATTCTATTTTATAATTTGTAAATTA
AAAATATTAATAAAATAAAACGATATAAAAGGATCCATGAGTAAAGGAGAAGAACTTTTC
ACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCT
GTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGC
ACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTT
CAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATG
CCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACA
CGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATT
GATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACAC
AATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGA
CACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATT
GGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCG
AAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGG
ATTACACATGGCATGGATGAACTATACAAAGGGATCCTGGCTAGCCAGTCGACCTGCAGG
CATGCAAGCTTGCGGCCGATCCAAATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCG
CCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGA
TACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACG
TACGCGGAATACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTG
AATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTG
TTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGT
GAATTGCTCAACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGGGG
TTGCAAAAAATTTTGAACGTGCAAAAAAAATTACCAATAATCCAGAAAATTATTATCATG
GATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTA
CCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAATT
GCACTGATAATGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCAT
AGAACTGCCTGCGTCAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATT
CCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAATGTTTACTACA
CTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTG
TTTTTACGATCCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTATTT
TCATTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTACACGAAATT
GCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAAACGCTTCCAT
CTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACA
CCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAG
GTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAGAGAGGCGAATTATGTGTC
AGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATT
GACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTC
TTCATAGTTGACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCT
GAATTGGAATCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTCTT
CCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACG
ATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTG
CGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCA
AGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTGTAATTC
TAGAAGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTGTATTTATAACTGTA
AAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGCATGTAAATAGCTAA
AATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACACACATAAAATGGCTA
GTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATGACCATATTAAAAAT
TTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAATTATTATTATTATTA
TTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAATAGTTGGACTTGAT
TTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGTTGAAAAATTAAAAA
AAAACATATAAACACAAATGATGTTTTTTCCTTCAATTTCGGGTAC
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerNo
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c/d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4