Summary

RMgm-697
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_0500200; Gene model (P.falciparum): Not available; Gene product: BIR protein PIR protein
Name tag: mCherry
Phenotype Asexual bloodstage;
Last modified: 2 December 2012, 15:28
  *RMgm-697
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23197789
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherE.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard
Name Group/DepartmentDepartment of Parasitology
Name InstituteBiomedical Primate Research Centre
CityRijswijk
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-697
Principal name1918cl4
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageThe tagged-protein is exported into the cytoplasm of the host erythrocyte and shows a diffuse or patchy localization in the cytoplasm
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation

Protein (function)

Phenotype

Additional information
The mutant parasite expresses an mCherry-tagged protein. The protein has been selected for tagging in a screen for putative exported proteins of P. berghei.

The genotype of the parasites has not been analysed in detail.
Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) has been performed (see below). This analysis provided evidence for tagging of the correct gene. The construct used aims at integration of the tagging construct by single-cross-over integration resulting in the presence of a tagged copy of the endogenous gene.

Phenotype analyses of the blood stages by fluorescence microscopy show that the tagged-protein is exported into the cytoplasm of the host erythrocyte and shows a diffuse or patchy localization in the cytoplasm.



Other mutants


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0500200
Gene Model P. falciparum ortholog Not available
Gene productBIR protein PIR protein
Gene product: Alternative name
Details of the genetic modification
Name of the tagmCherry
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodiesClontech
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC
ATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGA
GATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTC
CAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACC
CTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAG
CCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAA
AGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCAC
CACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCATTCAGGCTGCG
CAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGG
GGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTG
TAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGAGCTCCA
CCGCGGCGTATATGCATTAATAACTATAACAATAGAATATATAAAATAAAAATGAACTGT
GCAAAACATTTAGCGAATATTTATCTAAATTTATATAGTAAAAGAGAAAATATATCTTAT
CTCTCTTCTCTTAAAATGCAATATAACAACCTAATTAAACATAACTTTATATTATACTTT
AAAATTTGCATCAATACTTATTTATGTGTTAATATTTACTAAGCATTTTTTTAAAAATAA
TATGCATTCAAATACTTGTTTAAGCTTATAAATACTGGTCCAGTGCTAATTGTTATTTTA
AATAATGTAAAAGATGGGAAAATATATAATAAAATTATCCAACAGAGAATACTTCTAAAT
TGGGATATGCAGGAATAAAAATAAAGTTATTTAACGCATTAAAATTATTTTTTAATTTAT
CTATATTAAATACAAATAATATAAATTTAAATAATTTGTATAGAAAATGAGGCATGTAAC
TAAATTTGAAAATGCTATTATTTTAGAAAAAACTATAATATATATTATAAGAAACAAGTA
TACACAAATTTAATATATTTAAAAAATCACTATTTATATATTTTAAGAATTCTAATAATA
ATAACTTTCTTAATTTTTTGTATTTGTGTAGTATTTGAGTTTTATGACGTTGTTTGTGTT
CTATATTAAAGCATATGTATAAGTATATATTTGTTAAATTCATTATAAAAGTATATCTAT
TTTTATAATAAAGTTATACCAAGTGTTAGTAAGAATAGTATTTTTTGTATAAAATTCATC
ATATATACATATGGCAAAAGTGTATAAGCAACCTTCTATTTAAGGTAATTTAGCTAACTG
CCATAAAATAAGTATAATATAATTTTAGTAATACTAATGTATTATTATTTTACATGAAGT
TAAAATTAAGAATAATATGTCTAACGAAAGATAATTTATATGTAAAGATCTTGAGTAAAT
ATACCATATATTCTATGCAATATATATAAACAACATCACCCCGCATAATCTCCAAATTAT
AACAGAATTTCATTATAATGTCTTTTAGAGTGGTATATACATTTTTTCTTATATTATTCG
TATGTTGCATTCCTACAAATTATATTAATTTTAATTTTAGTAACATTTATATTAATACAT
TTTTTGTTTAATTCGTAAAATATATTCGTAGTGTTATATAATTAGTGAGATTGATAATTT
TGCTAATGATCCGAAAAACCAGGGAGGACATAATTCTATTGGTTATTTTAAGTATTATTG
CCCTGATAATAACTGTGATACTGATGTCAAAAAAGTTATTTCTACTTTTATAGCATTAGT
AACTTTATTTAATGGTATTAATCATAATGAAAAATTAGAGAGTGATAAAATTGCTGAATA
TGCTATTTTATGGTTAAGTTATAAACTAAATCAAAAAACACAAAATGGAAACACCAAATT
ATACGATTTTTATACTGAACATATAAACACAAATAGTAAATATAATGAGCATATAACTAA
TGATTTTAATATTAATAAGAGTGTTATAGAAAATAAAATAAAATTGATGAATATGAATAT
TAAAGATATATCTAAATTTTATGATGCATTTAAAAAATTATGTGAAATGTATACTGAATT
TGATGACGACAATAAAAATTGCACAAACTGTTCGGGAAAAGCTAAAGAATTTGTTGAAAA
ATATAAAGACCTTAACAAAGATTATAATAACACTAATAGCAGTTCCTATAATAAAATGTT
GTCTACTTTATCAACTGATTATAATAATTTAAAAAATAAATGTAAAAATGTTCAAAATAG
CAAGTTTCCACTCCTTCCAGAGATAAAAACAACACAAATTTCTGTAAAAAGTTCTGAACA
AACTTCTGCACAAACATCTGAAGTTGCATCATCAAGGTCGTCGATAGGAAACAACTTATT
TACAGTTTTATCGGTATTTGGTGCAATAGCATTATTTTTAGGAATTGGATATAAGGTAAA
TAATAAGGAATTAAAAAAAAATACTATATATATGTAAACATTAACAAACAACCGTACGCT
TCTTAACATTTTATATTAGCATTCGTTATTTGGATTTCGGAGAAAAGTTCAAAAAAATTT
AAGAAAAAAGCTAAAATCATTAAGAAGAAAATGGATAATTAGTATAGGATCCGGTGGAGG
TGGAAGATCCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCAT
GCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGA
GGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGG
CCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTA
CGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAA
GTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTC
CCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGA
CGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCC
CGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCA
CTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGC
CTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGA
ACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTA
ATCTAGAATTATTAATATATATGAATATATATACATCGTTGTATGCGTAATATACGTGTA
ACTGTTTTTTTTAATTTTTATATTAACTTTTCCTTATACATTTTAATGCCATTAACTAAT
AATATTTTACTTGAAAAAATTCTAAATTTTTATAACTCTAATATAAAATCTGTGAATAAT
AAAAAATTAGCATAAAGTACGAATTAAACATCGAATATTTGTTTTAAAGGGGCACACATT
ATGTGCATATAATTTTATTCTTTGAATTTAATTTTTTGCTTATAATTAGATTAAATTAAT
ATAATTTTTTTATTGAAAATAAAAACTTATTTTAAAAAATTAACAAATGGAAGTTAATGA
AAAATACGAAAAAAGTAAAGGGTTAATTCTTATATGGTCGGTACCGAAATTGAAGGAAAA
AACATCATTTGTGTTTATATGTTTTTTTTTAATTTTTCAACTTTTTTTATTTAACTATGC
TAATCATATTATAAACATTTTAAAAATCAAGTCCAACTATTTATGAATCATTGAAGAGAC
AACATAATTATAACAGTAAAAATAATAATAATAATAATAATTTTGTCTTATTGTTTCAAA
CATATTATGTTCCATAAATATCTAAATTTTTAATATGGTCATAAATTCATAGGATTTAAT
TTATATAAAATATGGCTATTCATACTAGCCATTTTATGTGTGTAAAGTTTTTTTTTTCTG
AACAAAAAATAAAATGTTCATAATTTTAGCTATTTACATGCATGTGCATGCACAAAAAAA
AATATGCACACAACATACACATTTTTACAGTTATAAATACAATCAATTGGTATAAATATA
TAAATAAGAAAAACGAACATTAAGCTGCCATATCCCTCGACTAATCATTCTTCTCATATA
CTTCAAATTTGTACTTAATGCCTTTCTCCTCCTGGACATCAGAGAGAACACCTGGGTATT
CTGGCAGAAGTTTATATTTCTCCAAATCAATTTCTGGAAAAAACGTGTCACTTTCAAAGT
CTTGCATGATCCTTGTCACAAATAGTTTAAGATGGCCTGGGTGATTCATGGCTTCCTTAT
AAACAGAACTGCCACCAACTATCCAGACCATGTCTACTTTATTTGCTAATTCTGGTTGTT
CAGTAAGTTTTAAGGCATCATCTAGACTTCTGGAAAGAAAATGTGCACCTTGTGGAGGTT
CCTTGAGTTCTCTGCTGAGAACTAAATTAATTCTACCCTTTAAAGGTCGATTCTTCTCAG
GAATGGAGAACCAGGTCTTCTTACCCATAATCACCAGATTCTGTTTACCTTCTACTGAAG
AGGTTGTGGTCATTCTCTGGAAATATCTGAATTCATTCCTGAGCGGTGGCCAGGGCAGGT
CCCCGTTCTTGCCGATGCCCATGTTCTGGGACACAGCGACGATGCAGTTTAGCGAACCAA
CCATTTTTATAAAATTTTTATTTATTTATAAGCAAATATATATTTTTATATATTTATACA
CAAAGTATATATATTTTAGGAAATATTAAAATAAATTTAAATTTTGAAGGCAAATGAAAA
AATTACGTTTTTTGTTTCACAACAATTATATTTATTTTTTGAATTAATTTACATATTATT
TTATATTAAAATTATAAAATAAAAAAAACATTACATATATTAATTATATTATTATATGAG
GATTTTTTTATAACATAGAAATATAAATAATTACGACTAGTTAATAAAGGGCACTTTAAT
TTTTATGCATAATTAGCTTATATTTAGTGCATATTTATTTTTATACATATTTTTATATAT
TTTTTGATTTACATGGCGTTTTATGTTTATATGTATAACATTATATGCATAGTATTTTTT
TGAAAATTTAATGGTATTTCAGTGGATGAAAATATTACTGGTGCTTTGAGGGGTGAGCAT
TTAAAGCACAATATCTAGGATACTACAAAAAATACTTAAAGTATGAATATTAAATTGTAA
ACTTAAGCATAAAGAGCTCGAAAAGAATTAAGCTTAACTCATCTACAAGCATCGTCGACC
TCGAGGGGGGGCCCGGTACCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTG
GCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACAC
AACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTC
ACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTG
CATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCT
TCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCAC
TCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGA
GCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCAT
AGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC
CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCT
GTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCG
CTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG
GGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGT
CTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGG
ATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTAC
GGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA
AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTT
GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT
TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA
TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATC
TAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT
ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA
ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCA
CGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA
AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA
GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTG
GTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA
GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT
GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT
CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCA
TTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT
ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA
AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC
AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG
CAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC
CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT
GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA
C
Restriction sites to linearize plasmid BglII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGCGGCGTATATGCATTAATAACTATAAC
Additional information primer 1L5708 (SacII); PBANKA_050020 Forward
Sequence Primer 2CGGATCCTATACTAATTATCCATTTTCTTCTTAATG
Additional information primer 2L5709 (BamHI); PBANKA_050020 Reverse
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6