Back to search resultsSummaryRMgm-693
|
||||||||
*RMgm-693| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23197789 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | E.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard |
| Name Group/Department | Department of Parasitology |
| Name Institute | Biomedical Primate Research Centre |
| City | Rijswijk |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-693 |
| Principal name | 1448cl2 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | The tagged-protein is exported into the cytoplasm of the host erythrocyte and shows a diffuse or patchy localization in the cytoplasm |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | The tagged protein is expressed in late liver stages (schizonts) where it is located in the parasitophorous vacuole. |
| Additional remarks phenotype | Mutant/mutation The mutant parasite expresses an mCherry-tagged protein. The protein has been selected for tagging in a screen for putative exported proteins of P. berghei. The genotype of the parasites has not been analysed in detail. Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) has been performed (see below). This analysis provided evidence for tagging of the correct gene. The construct used aims at integration of the tagging construct by single-cross-over integration resulting in the presence of a tagged copy of the endogenous gene. Phenotype analyses of the blood stages by fluorescence microscopy show that the tagged-protein is exported into the cytoplasm of the host erythrocyte and shows a diffuse or patchy localization in the cytoplasm.
The protein is not detected in oocysts and in sporozoites. The tagged protein is expressed in late liver stages (schizonts) where it is located in the parasitophorous vacuole.
|
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1327300 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
| Gene product | fam-a protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | mCherry | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | Clontech | ||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AACATATTATGGGACCCCAATGGCGCAAAGAACTTCGATGATAAATTTATTAAAGGTATA
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | HpaI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||