RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-651
Malaria parasiteP. yoelii
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PY17X_1033500; Gene model (P.falciparum): PF3D7_1411400; Gene product: plastid replication-repair enzyme (Prex)
PhenotypeNo phenotype has been described
Last modified: 31 August 2011, 15:44
  *RMgm-651
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification ≥ 5
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21856338
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line17XNL is a non-lethal strain of P. yoelii
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherS.E. Lindner; S.H.I. Kappe
Name Group/DepartmentDepartment of Biomolecular Chemistry
Name InstituteUniversity of Wisconsin School of Medicine and Public Health
CityMadison, Wisconsin
CountryUSA
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PY17X_1033500
Gene Model P. falciparum ortholog PF3D7_1411400
Gene productplastid replication-repair enzyme
Gene product: Alternative namePrex
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SbfI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe protein Prex is located in the apicoplast and contains potential primase, helicase, exonucease and polymerase domains. In the paper evidence is presented that the primase domain of Prex of P. falciparum plays a role in the production of RNA primers for lagging strand DNA synthesis of the apicoplast genome.

The unsuccessful attempts to disrupt indicates that Prex has an essential function during asexual growth/multiplication

Regions of homology (800-900bp in length) located just 5’ and 3’ of the PyPrex open reading frame were PCR amplified (primer pairs 1&2 and 3&4), combined by SOE (Splicing by Overlapping Extension; Mikolajczak, S.A., et al.(2008)), PCR (primer pair 1&4), and inserted into the StuI site of pCR-Blunt (Invitrogen) for sequencing. The combined homology regions were released from pCR-Blunt by digestion with SacII and NotI and inserted into the same restriction sites of a B3d-derived plasmid. The B3d-PyPrexKO plasmid was linearized with SbfI.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATATTCGTGCCTGCAGGGTTGCCCTCATTTATATGCCTATATATACAATGCCC
Additional information primer 1PyPrex-KO-5’UTR-Fwd
Sequence Primer 2GTGCGGCCGCTTCTCATTGGGGCAATTATTTTTTACTTG
Additional information primer 2PyPrex-KO-5’UTR-Rev
Sequence Primer 3CCGATATCCCATACCCATTAAGGTATGTCAAACTATG
Additional information primer 3PyPrex-KO-3’UTR-Fwd
Sequence Primer 4GAGGGCAACCCTGCAGGCACGAATATATACGTATACATATACATGCG
Additional information primer 4PyPrex-KO-3’UTR-Rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren