Back to search resultsSummaryRMgm-639
|
||||||||||
*RMgm-639| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 4 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 21803864 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 1037m1f1mocl1 (RMgm-32) |
| Other information parent line | P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | B. Balu; J.H. Adams |
| Name Group/Department | Department of Global Health, College of Public Health |
| Name Institute | University of South Florida, College of Public Health |
| City | Tampa, Florida |
| Country | USA |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1426200 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0811300 | ||||||||||||||||||||||||
| Gene product | CCR4-associated factor 1 | poly(A) ribonuclease POP2 | ||||||||||||||||||||||||
| Gene product: Alternative name | carbon catabolite repressor protein 4 (CCR4)-associated factor 1 (CAF1) | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | PCR construct | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() ATTGGGGAACTTGTTCACCATTTCTATTACATTATATATATTAGGACACAATATAATAAA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | Asp718, ScaI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | The carbon catabolite repressor protein 4 (CCR4)-Not complex is a well-conserved, eukaryotic gene regulatory complex, broadly divided into two modules: CCR4 and CCR4-associated factor 1 (CAF1), regulating mRNA decay, and the Not proteins, regulating transcription and protein degradation. In yeast and other eukaryotes, CAF1 has a major role in determining transcript levels through regulated deadenylation of mRNA. Members of the CCR4-Not complex are well conserved in all Plasmodium species, suggestive of their significance in parasite gene regulation. The unsuccessful attempts to disrupt CAF1 indicates an essential role during asexual blood stage development of P. berghei. In P. falciparum a 'CAF1-knock out mutant' has been generated and selected by piggyBac-mediated mutagenesis. Asexaul blood stages of this mutant show a severely attenuated growth rate. Phenotype analyses of the P. falciparum mutant indicates that the average number of merozoites/schizont and the length of the cell cycle is similar to that of wild type parasites. However, merozoites show a defect in egress from the host erythrocyte. In order to create a P. berghei caf1 deletion mutant, constructs were generated which would target the gene by double-crossover homologous recombination. These constructs were amplified using an adapted anchor-tagging PCR-based method for generation of gene deletion constructs. This method employs a two-step PCR. In the first PCR, two flanking fragments (5' and 3' target) were amplified using genomic DNA (cl15cy1) as the template with the primer pairs 4674/4726 (5' UTR in construct pL1518; GAACTCGTACTCCTTGGTGACGGGTACCATTGGGGAACTTGTTCAC/CATCTACAAGCATCGTCGACCTCTCACTTTTTGCATACTACAC) or 5342/5343 (5'UTR in construct pL1585; GAACTCGTACTCCTTGGTGACGGGTACCTCCTTATGTAGCCATTGAC/CATCTACAAGCATCGTCGACCTCCCAAGCCATATATAATACCTG) and 4727/4675 (3'UTR both constructs; CCTTCAATTTCGGATCCACTAGTGTGGCTTGTGTTAAAGAC/AGGTTGGTCATTGACACTCAGCAGTACTGCCTCTTCCCATTATTCTG). The 5'UTR targeting region in pL1585 was moved approximately 800 bp downstream compared to construct pL1518, leaving 770 bp of the 5’ ORF intact. The primers 4726, 5343, and 4727 have 5'-terminal extensions homologous to the hdhfr selectable marker (SM) cassette. This cassette contains hdfr under the control of the ef1a promoter region and the 3' untranslated region (UTR) pbdhfr/ts and is obtained from plasmid pL0040 by digestion with restriction enzymes XhoI and NotI (pL0040 is available from The Leiden Malaria Research Group). Primers 4674, 5342, and 4675 have a 5'-terminal overhang with an anchor tag suitable for the second PCR. In the second PCR, the fragments were annealed to either side of the hdhfr selectable marker cassette with anchor tag primers 4661/4662 (GAACTCGTACTCCTTGGTGACG/AGGTTGGTCATTGACACTCAGC), resulting in the second PCR fragment with the expected size, i.e., 3.0 kb (1.6 kb of the selectable marker cassette plus two targeting fragments). To remove the anchor tag from the final DNA construct, the second PCR fragment was digested with Asp718 and ScaI. Both constructs were used in two transfection experiments each, resulting in four independent attempts to disrupt P. berghei cafI. Transfections were carried out in 3 different parasite lines. Construct pL1518 was transfected into P. berghei ANKA 1037m1f1mocl1 (RMgm-32) and P. berghei ANKA 676m1cl1. P. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192). 676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). Construct pL1585 was transfected into P. berghei ANKA 1037m1f1mocl1 (RMgm-32) and P. berghei ANKA cl15cy1. P. berghei ANKA cl15cy1 is a reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). See RMgm-318 for independent attempts to disrupt P. berghei caf1 | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||