Summary

RMgm-630
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0816000; Gene model (P.falciparum): PF3D7_0915000; Gene product: type II NADH:ubiquinone oxidoreductase (NDH2)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0816000; Gene model (P.falciparum): PF3D7_0915000; Gene product: type II NADH:ubiquinone oxidoreductase (NDH2)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0816000; Gene product: type II NADH:ubiquinone oxidoreductase (NDH2)
Phenotype Oocyst; Sporozoite;
Last modified: 25 August 2011, 22:28
  *RMgm-630
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21771793
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherK.E. Boysen; K. Matuschewski
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-630
Principal namendh2(-) ko1; ndh2(-) ko2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of ookinetes are produced. Ookinetes showed normal (gliding) motility. Normal numbers of oocysts are produced. Mutant oocysts were considerably smaller than wild type oocysts. No sporozoite formation inside oocysts
SporozoiteNormal numbers of oocysts are produced. Mutant oocysts were considerably smaller than wild type oocysts. No sporozoite formation inside oocysts. No salivary gland sporozoites.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of type II NADH:quinone oxidoreductase (NDH2) and expresses GFP under the control of the ndh2 promoter.

Protein (function)
In Plasmodium parasites, NDH2 is one out of five mitochondrial dehydrogenases that feed electrons into the mitochondrial electron transport chain (mtETC). Typically, eukaryotes possess a multi-component rotenone-sensitive NADH:ubiquinone oxidoreductase, also termed complex I, which is located in the inner mitochondrial membrane. It catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q, Q) leading to the reduced form, ubiquinol (QH2), and is involved in establishing the electro potential across the inner mitochondrial membrane (Δψm) by pumping hydrogen ions out of the mitochondrial matrix. Plasmodium spp., however, has a rotenone-insensitive, single subunit NADH:quinone oxidoreductase, also termed alternative complex I or NDH2. This enzyme is found in some bacteria and archea as well as in yeast and plants.

Phenotype
Phenotype analyses indicate that NDH2 is not essential for asexual blood stages, gametocytes and ookinetes. NDH2 has an essential role during oocyst development and the formation of sporozoites.

Additional information
Expression of NDH2 was analysed using a parasite expressing an mCherry-tagged version of NADH2 (see RMgm-631). Immuno-fluorescence analyses using anti-mCherry antibodies showed low expression in asexual blood stages. Gametocytes displayed an intense punctuate or branched staining, indicative of abundant NDH2 protein that localizes to a cellular organelle, most likely the mitochondrion. In ookinetes, a prominent concentration of the signal in a branched structure adjacent to the parasite nucleus was detectable. NDH2 protein was prominent in oocysts and late liver stages, but absent in sporozoites. In gametocytes and ookinetes, the mCherry-signals showed overlap with signals of mitotracker, a mitochondrial-specific fluorescent dye.

Staining of ookinetes with the fluorescent dye JC-1 indicated a normal mitochondrial membrane potential. Ookinetes showed normal motility.

Crossing experiments between mutant and wild type parasites indicated that NDH2 is not essential for liver stage development

Other mutants
RMgm-631: A mutant expressing mCherry-tagged form of NDH2


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0816000
Gene Model P. falciparum ortholog PF3D7_0915000
Gene producttype II NADH:ubiquinone oxidoreductase
Gene product: Alternative nameNDH2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SpeI, KpnI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe wild-type NDH2 locus (WT) is targeted with a linearized replacement plasmid containing the 5´and 3´UTRs of PbNDH2, GFP, and the positive selection marker tgdhfr/ts. After double cross-over homologous recombination, the NDH2 open reading frame is substituted by GFP and the selection marker, resulting in the loss-of-function ndh2(-) allele. GFP is now expressed under the PbNDH2 promoter.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1atcaagcactagttctaattgtgcgtggtatac
Additional information primer 15ʼ KO flank for (SpeI)
Sequence Primer 2caatatcatatgttaaccatgcaaaggtgtg
Additional information primer 25ʼ KO flank rev (NdeI)
Sequence Primer 3taagcttggccattctactgatctgacatgtttag
Additional information primer 33ʼ KO flank for (HindIII)
Sequence Primer 4taggtaccgtacaaatccgagctttccctc
Additional information primer 43ʼ KO flank rev (KpnI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SpeI, KpnI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe wild-type NDH2 locus (WT) is targeted with a linearized replacement plasmid containing the 5´and 3´UTRs of PbNDH2, GFP, and the positive selection marker tgdhfr/ts. After double cross-over homologous recombination, the NDH2 open reading frame is substituted by GFP and the selection marker, resulting in the loss-of-function ndh2(-) allele. GFP is now expressed under the PbNDH2 promoter.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0816000
Gene Model P. falciparum ortholog PF3D7_0915000
Gene producttype II NADH:ubiquinone oxidoreductase
Gene product: Alternative nameNDH2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0816000
Gene producttype II NADH:ubiquinone oxidoreductase
Gene product: Alternative nameNDH2
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1atcaagcactagttctaattgtgcgtggtatac
Additional information primer 15ʼ KO flank for (SpeI)
Sequence Primer 2caatatcatatgttaaccatgcaaaggtgtg
Additional information primer 25ʼ KO flank rev (NdeI)
Sequence Primer 3taagcttggccattctactgatctgacatgtttag
Additional information primer 33ʼ KO flank for (HindIII)
Sequence Primer 4taggtaccgtacaaatccgagctttccctc
Additional information primer 43ʼ KO flank rev (KpnI)