RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-626
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0208300; Gene model (P.falciparum): PF3D7_0104800; Gene product: novel putative transporter 1, putative (Novel Putative Transporter, NPT1)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 21 August 2011, 15:04
  *RMgm-626
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21752110
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherB. Boisson; R. Ménard; P. Baldacci
Name Group/DepartmentBiologie et Génétique du Paludisme
Name InstituteInstitut Pasteur
CityParis
CountryFrance
Name of the mutant parasite
RMgm numberRMgm-626
Principal nameNPT1-Δ
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteStrongly reduced gametocyte production. The few gametocytes present show an aberrant morphology. These aberrant forms are unable to fertilize and produce ookinetes
Fertilization and ookineteNo ookinete production
OocystNo ookinete and oocyst production
SporozoiteNo ookinete, oocyst and sporozoite production
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Novel Putative Transporter, NPT1.

Protein (function)
The P. falciparum (PFA0245w) homolog of P. berghei NPT1 has been reported to belong to an uncharacterized family of 5 novel putative transporters (NPTs) presenting some features of the Major Facilitating Superfamily (MFS) (Martin et al., 2005, Genome Biol.).  Plasmodium NPT1 proteins are predicted to contain 12 transmembrane domains. Transcription/expression of the npt1 gene has been shown for blood-, mosquito- and liver stages with increased transcript levels in liver stages.

Phenotype
Phenotype analyses show a strongly reduced gametocyte production. The few gametocytes present show an aberrant morphology (as shown by both ligh-microscopy and transmission electron microscopy analyses). These aberrant forms are unable to fertilize and to produce ookinetes.

Additional information
Both the production of male and female gametocytes is affected as shown by the absence of ookinetes in cross-fertilisation studies with either fertile males or fertile female gametes.

The number of gametocytes in parasites lacking expression of NPT1 is 90-95% reduced as demonstrated by FACS counting of mature gametocytes. For FACS counting of male and female gametocytes the npt1 gene was disrupted in the reporter line Fluofrmg that expresses RFP and GFP under the control of female- and male-specific promoters (see mutant RMgm-629).

In the same study a mutant has been generated in which the npt1 gene was partially deleted (NPT1-I). These parasites show an unexpected presence of a long ‘chimeric’ transcript encompassing the entire disrupted locus. Since no antibodies against NPT1 could be generated, it was not possible to analyse whether these transcripts would give rise to a (truncated) NPT1 protein. This mutant showed however the same phenotype as the phenotype described here for the mutant lacking the complete npt1 gene.

In order to verify that the phenotype of mutant parasites was due solely to the genetic modifications introduced in the npt1 locus and not to other mutations that may have occurred during the selection of the parasites or to an effect on neighbouring genes, the NPT1-I strain has been complemented with an intact npt1 gene . To this end, a plasmid, c-npt1-gfp, containing 500bp of the 5’UTR, the entire ORF and 1000bp of the 3’UTR of npt1, together with gfp driven from the hsp70 promoter was inserted by single cross-over into the npt1-I locus. This insertion generated a full-length npt1 ORF driven by the native promoter and 1000bp of the endogenous 3`UTR. Phenotype analyses of the complemented parasites showed restoration of normal (wild type) gametocyte production.

Other mutants
RMgm-624: A mutant expressing a HA-tagged form of NPT1.
RMgm-629: A mutant that lacks expression of NPT1 and expresses RFP and GFP under the control of female- and male-specific promoters.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0208300
Gene Model P. falciparum ortholog PF3D7_0104800
Gene productnovel putative transporter 1, putative
Gene product: Alternative nameNovel Putative Transporter, NPT1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1cgatgcgggcccctggctaattttgctattcatcattttac
Additional information primer 1Upstream targeting region forward (ApaI)
Sequence Primer 2cgatgccccgggatttcgaaataaatatattttatattctcaaatatg
Additional information primer 2Upstream targeting region reverse (XmaI)
Sequence Primer 3ccagtgagtgcggccgcgggcctgatttattcattaacctttttagc
Additional information primer 3Downstream targeting region forward (NotI)
Sequence Primer 4agctggcgcgccacagcgtgggtaaaacgaccgt
Additional information primer 4Downstream targeting region reverse (AscI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6