SummaryRMgm-585
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 21453484 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | J. Thompson; K.D. Augustijn |
Name Group/Department | Institute of Immunology and Infection Research |
Name Institute | School of Biological Sciences, University of Edinburgh |
City | Edinburgh |
Country | UK |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-585 |
Principal name | 376cl1; 376cl2 |
Alternative name | Δpcrmp4 |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Normal numbers of oocysts are produced. Inside oocysts morphologically normal sporozoites are formed. Sporozoites fail to egress from oocysts. No sporozoites are found in the salivary glands. |
Sporozoite | Normal numbers of oocysts are produced. Inside oocysts morphologically normal sporozoites are formed. Sporozoites fail to egress from oocysts. No sporozoites are found in the salivary glands. Mechanically liberated sporozoites from oocysts show gliding motility and invade and infect hepatocytes but do not undergo further development. |
Liver stage | Mechanically liberated sporozoites from oocysts show gliding motility and invade and infect hepatocytes in vitro but do not undergo further development. |
Additional remarks phenotype | Mutant/mutation crmp4 was also disrupted in the GFP-reporter line P. berghei ANKA 507cl1 (RMgm-7) using the same method/plasmid as described here (line 659m1cl1). In addition, 'double knock' mutants have been generated lacking both CRMP3 and CRMP4 (line 656m2cl1, 656m2cl2). Details of these lines have not been published. CRMP4 has been tagged with GFP (line 478) and cmyc (line 1109) but parasites of these lines have not been analysed in detail. |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1300800 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1475400 | ||||||||||||||||||||||||
Gene product | cysteine repeat modular protein 4 | ||||||||||||||||||||||||
Gene product: Alternative name | CRMP4 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map |
![]() | ||||||||||||||||||||||||
Plasmid/construct sequence |
![]() ![]() AATTCATATGGTACAAACTATGGGATACGATGACCACACTATTAAAAATAAAAATTATAA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | KpnI, BamHI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption |
CRM-4 cds: 16360bp Disrupted region: 10969 - 14594 | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
![]()
| |||||||||||||||||||||||||
top of page |