RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-5518
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CSP)
Details mutation: The P. berghei csp gene replaced by P. falciparum csp
Transgene
 Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (P230p; 230p)
Phenotype Oocyst; Sporozoite;
Last modified: 18 June 2024, 15:56
  *RMgm-5518
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 38051195
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherGreen EI, Marois E
Name Group/DepartmentInserm U1257, CNRS UPR9022
Name InstituteUniversity of Strasbourg
CityStrasbourg
CountryFrance
top of page
Name of the mutant parasite
RMgm numberRMgm-5518
Principal namePb-PfCSP(hsp70-GFP).
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystStrong GFP expression in oocysts and sporozoites
SporozoiteStrong GFP expression in oocysts and sporozoites
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
In the mutant the endogenous P. berghei csp gene has been replaced by the P. falciparum csp gene. In addition, the mutant expresses GFP under the control of the HSP70 promoter. The reporter gene is introduced into the silent 230p locus.

This mutant was generated by crossing the following two published mutant lines:  a novel P. berghei mutant was generated by combining the strong GFP fluorescence of Δp230p-GFP (RMgm-1026) with the substitution of endogenous P. berghei CSP for CSP from P. falciparum from strain Pb-PfCSP (RMgm-4110), in which GFP fluorescence was too faint for selecting live infected mosquitoes examined under 488 nm light.

Protein (function)

Phenotype
Strong GFP expression in oocysts and sporozoites

Additional information

Other mutants

  Mutated: Mutant parasite with a mutated gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCSP
top of page
Details of the genetic modification
Short description of the mutationThe P. berghei csp gene replaced by P. falciparum csp
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedureNo
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationWe generated a novel P. berghei strain combining the strong GFP fluorescence of Δp230p-GFP (RMgm-1026) with the substitution of endogenous P. berghei CSP for CSP from P. falciparum from strain Pb-PfCSP (RMgm-4110), in which GFP fluorescence was too faint for selecting live infected mosquitoes examined under 488 nm light. For this, 150 mosquito females were allowed to blood feed on a mouse co-infected with both parental parasite strains at a ratio of 1 strongly fluorescent Δp230p-GFP for 40 Pb-PfCSP. Sexual reproduction of P. berghei in the mosquito generates hybrid haploid sporozoites, some of which inherit both Δp230p-GFP and Pb-PfCSP. Seventeen days after their infective blood meal, live female mosquitoes were screened under 488 nm light to select those displaying visible GFP sporozoites trapped at the base of their wing veins. 20 positive females were offered a blood meal on a naïve mouse. When parasitemia reached 0.1%, 3000 strongly GFP positive blood stage parasites were sorted by flow cytometry and injected intravenously into two naïve mice, only one of which developed parasitemia 11 days after passage. Its blood was then passaged into a new mouse. When parasitemia reached 0.4%, 10 new mice were injected with a blood dilution corresponding to 1 parasite each, although this number was probably underestimated as all 10 mice developed parasitemia. Of these, four mice tested PCR positive for PfCSP (PCR primers GGCCTTATTCCAGGAATACCAGTGCT / GGATCAGGATTACCATCCGCTGGTTG) and negative for PbCSP (PCR primers GAAGAAGTGTACCATTTTAGTTGTAGCGTC / TGGGTCATTTGGGTTTGGTGGTG). We selected one clone for passage into naive mice, confirmed its PCR negativity for PbCSP and positivity for PfCSP, this clone was called Pb-PfCSPhsp70-GFP.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationWe generated a novel P. berghei strain combining the strong GFP fluorescence of Δp230p-GFP (RMgm-1026) with the substitution of endogenous P. berghei CSP for CSP from P. falciparum from strain Pb-PfCSP (RMgm-4110), in which GFP fluorescence was too faint for selecting live infected mosquitoes examined under 488 nm light. For this, 150 mosquito females were allowed to blood feed on a mouse co-infected with both parental parasite strains at a ratio of 1 strongly fluorescent Δp230p-GFP for 40 Pb-PfCSP. Sexual reproduction of P. berghei in the mosquito generates hybrid haploid sporozoites, some of which inherit both Δp230p-GFP and Pb-PfCSP. Seventeen days after their infective blood meal, live female mosquitoes were screened under 488 nm light to select those displaying visible GFP sporozoites trapped at the base of their wing veins. 20 positive females were offered a blood meal on a naïve mouse. When parasitemia reached 0.1%, 3000 strongly GFP positive blood stage parasites were sorted by flow cytometry and injected intravenously into two naïve mice, only one of which developed parasitemia 11 days after passage. Its blood was then passaged into a new mouse. When parasitemia reached 0.4%, 10 new mice were injected with a blood dilution corresponding to 1 parasite each, although this number was probably underestimated as all 10 mice developed parasitemia. Of these, four mice tested PCR positive for PfCSP (PCR primers GGCCTTATTCCAGGAATACCAGTGCT / GGATCAGGATTACCATCCGCTGGTTG) and negative for PbCSP (PCR primers GAAGAAGTGTACCATTTTAGTTGTAGCGTC / TGGGTCATTTGGGTTTGGTGGTG). We selected one clone for passage into naive mice, confirmed its PCR negativity for PbCSP and positivity for PfCSP, this clone was called Pb-PfCSPhsp70-GFP.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative nameP230p; 230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
P.berghei model of malaria
Technical design and realization: S. Mededovic and A. van Wigcheren