RMgmDB - Rodent Malaria genetically modified Parasites
SummaryRMgm-54
|
||||||||
*RMgm-54| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 12615325 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei NK65 |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | P. Bhanot, V. Nussenzweig, C. Persson |
| Name Group/Department | Department of Pathology |
| Name Institute | New York University School of Medicine |
| City | New York |
| Country | USA |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-54 |
| Principal name | TRAPYI/AA mutant |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Not different from wild type |
| Sporozoite | Normal numbers of midgut sporozoites are formed. Micronemal and cell surface localization of TRAP is affected (reduced) but not secretion of TRAP (into the culture medium). Gliding motility is affected (sporozoites formed about 60% as many trails as did wild type). Mutant sporozoites were affected in cell-traversal capacity as shown by the 'cell-wound assay' using Hepa1-6 cells (about twice as many dextran-rhodamine positive-Hepa1–6 cells in cultures of wild type sporozoites compared to culutes of mutant sporozoites). Sporozoites showed decreased infectivity to Hepa1-6 cells in vitro (mutant sporozoites had about 50–80% fewer EEFs than those infected by wild type parasites). Sporozoites showed decreased infectivity to BALB/c mice (parasite load in the mice infected with mutant sporozoites was 99% less compared with mice injected with wild type parasites). |
| Liver stage | Mutant sporozoites were affected in cell-traversal capacity as shown by the 'cell-wound assay' using Hepa1-6 cells (about twice as many dextran-rhodamine positive-Hepa1–6 cells in cultures of wild type sporozoites compared to culutes of mutant sporozoites). Sporozoites showed decreased infectivity to Hepa1-6 cells in vitro (mutant sporozoites had about 50–80% fewer EEFs than those infected by wild type parasites). Sporozoites showed decreased infectivity to BALB/c mice (parasite load in the mice infected with mutant sporozoites was 99% less compared with mice injected with wild type parasites). |
| Additional remarks phenotype | Mutant/mutation Protein (function) Phenotype Other mutants |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1349800 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1335900 | ||||||||||||||||||||||||||
| Gene product | thrombospondin-related anonymous protein | sporozoite surface protein 2 | ||||||||||||||||||||||||||
| Gene product: Alternative name | sporozoite surface protein 2; SSP2; SSP-2; TRAP | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | Mutation in the cytoplasmic tail (abrogation of the tyrosine motif) | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | Plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | pbdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The construct used results in 'disruption of the wild type trap-gene and introduction of a full length mutated trap gene under control of the wild type regulatory (3'UTR, 5'UTR) sequences. In the mutated gene the tyrosine motif (Y562NFI) of its cytoplasmic tail was changed to A592CFA resulting in abrogation of the tyrosine motif (this motif conforms to the consensus of the YXXΦ sorting motif of proteins). The plasmid used to construct the mutant TRAPYI/AA is derived from the previously described plasmid INCO. pINCO contains a truncated copy of TRAP (missing nt 1–67). The insertion plasmid was created by replacing the AgeI–PstI fragment of TRAP open reading frame (ORF) in INCO with a PCR product carrying the mutation. The PCR product was generated using 5′ primer TRAP-AGE (CACCAAAACCGGTAGCTCCTC) that contains a site for AgeI and hybridizes from nt 840 onwards. The 3′ PCR primer was PB14SphSac (TTGCTGCAGCGCTACTTCCCGCGGCAAAGCATGCACCAACACCTATGCATCCAATT) that contains sites for PstI, SphI and SacII and hydridizes from nt 1720 onwards. The resulting PCR product was cloned into pCR 2.1-TOPO vector (Invitrogen), excised as a AgeI–PstI fragment and used to replace the corresponding fragment of INCO cut with AgeI and PstI. When the Y592NFI sequence was changed to A592CFA in TRAPYI/AA, SphI and SacI sites within the Y-motif. This allowed tagging the mutation and ruling out the possibility of it being corrected during the integration and recombination step, as occurs frequently in P. berghei. It was reasoned that the cysteine residue in the mutant motif was unlikely to be disruptive for the protein structure since the remainder of the TRAP tail does not contain cysteine residues required for the formation of disulfide bonds. Further, the mutant motif’s cysteine residue is in a position (Y XΦ) that does not require a specific amino acid. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
