top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0522400
|
Gene Model P. falciparum ortholog |
PF3D7_0422000
|
Gene product | steroid dehydrogenase, putative |
Gene product: Alternative name | Ketoacyl-CoA reductase, steroid dehydrogenase, KCR |
top of page |
Details of the genetic modification |
Name of the tag | GFP |
Details of tagging | C-terminal |
Additional remarks: tagging | |
Commercial source of tag-antibodies | |
Type of plasmid/construct | (Linear) plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | eef1a |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | To generate a parasite line expressing KCR fused to GFP (KCR/GFP), the coding sequence of PBANKA_0522400 plus approximately 0.45 kb of the 5′UTR was PCR amplified with primers pDNR-05524-F (ACGAAGTTATCAGTCGAGGTACCTGATTCAACTATATTACCGCAGATAC) and pDNR-05524-R (ATGAGGGCCCCTAAGCTTTCTTCTTTCTTCATTTTTTTCAAC) and introduced into SalI/HindIII-digested pDNR-EGFP via In-Fusion cloning to give plasmid pDNR-KCR/EGFP. An approximately 0.77 kb sequence corresponding to the 3′UTR of PBANKA_005524 was PCR amplified with primers pLP-05224-F (ATATGCTAGAGCGGCCAGTGTGCTCACTTTTTGTTATTTTG) and pLP-05224-R (CACCGCGGTGGCGGCCTTTGGAAAATATGCAAAGC) and introduced into NotI-digested pLP-hDHFR via In-Fusion cloning to give plasmid pLP-hDHFR/KCR. The kcr-specific sequence from pDNR-KCR/EGFP was introduced into pLP-hDHFR/KCR via Cre-loxP site-specific recombination to give the final construct pLP-KCR/EGFP. This plasmid was linearised with KpnI and SacII and transfected into purified schizonts for integration into the kcr locus by double crossover homologous recombination |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |