Summary

RMgm-532
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0205800; Gene model (P.falciparum): PF3D7_0107600; Gene product: serine/threonine protein kinase, putative (initiation factor 2alpha (eIF2alpha) kinase 2)
Phenotype Fertilization and ookinete; Oocyst; Liver stage;
Last modified: 21 December 2011, 16:28
  *RMgm-532
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20951971
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherR. Tewari, O. Billker
Name Group/DepartmentUniversity of Nottingham
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-532
Principal nameK42 eik2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteOokinete numbers (in vitro) reduced to 52% of wild type
OocystOocyst numbers (day 12-14) reduced to 20% of wild type
SporozoiteNot different from wild type
Liver stagetransmitted by mosquito bite
Additional remarks phenotype

The gene has been targeted for gene deletion using a construct aimed at integration into the genome by double cross-over homologous recombination

The gene has been targeted for disruption in a 'kinome-wide' study for deletion of genes encoding Plasmodium protein kinases (protein kinase-like proteins).

See the paper for additional information on the analysis of the phenotype.

See RMgm-482 for an independen mutant lacking expression of PBANKA_020580. Phenotype analyses of this mutant showed the following characteristics: Fertilisation and ookinete formation NOT different from wild type; Oocyst production and development NOT different from wild type; Normal numbers of salivary gland sporozoites; Sporozoites showed reduced gliding motility and cell traversal capacity in vitro. Invasion of HepG2 cells in vitro was comparable to that of wild type parasites. Infectivity of sporozoites to mice was strongly reduced (as tested by intravenous injection of purified sporozoites or after infection of mice by mosquito bite). Salivary gland sporozoites show premature development into early liver stage forms.

See below for a picture showing the location of the target regions used to disrupt PBANKA_020580 in the mutant described here and for mutant RMgm-482

 

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565). After transfection with a KO vector a strong PCR signal diagnostic for gene disruption was observed in transfected populations indicating that this gene is not essential for asexual proliferation. Cloning will however be required to validate this interpretation for this
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0205800
Gene Model P. falciparum ortholog PF3D7_0107600
Gene productserine/threonine protein kinase, putative
Gene product: Alternative nameinitiation factor 2alpha (eIF2alpha) kinase 2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption partial (insertion/deletion in 3' kinase domain)
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCGAATCCAGTATCAAACATAGATAATG
Additional information primer 1primer sequence target region 1a
Sequence Primer 2GGGGAAGCTTGTGGTCATCCAAATAATCATATG
Additional information primer 2primer sequence target region 1b
Sequence Primer 3CCCCGAATTCGAAACCTTCGGAGTTGCAAAAG
Additional information primer 3primer sequence target region 2a
Sequence Primer 4GGGGTCTAGAGTGCCGAAGTTGGTCTAGATTTG
Additional information primer 4primer sequence target region 2b
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6