top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_1104100
|
Gene Model P. falciparum ortholog |
PF3D7_0504500
|
Gene product | MOLO1 domain-containing protein, putative |
Gene product: Alternative name | TPM2 |
top of page |
Details of the genetic modification |
Name of the tag | GFP |
Details of tagging | C-terminal |
Additional remarks: tagging | |
Commercial source of tag-antibodies | |
Type of plasmid/construct | (Linear) plasmid single cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Selectable marker used to select the mutant parasite | hdhfr |
Promoter of the selectable marker | eef1a |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The entire coding sequence of PBANKA_1104100 plus ca. 0.6 kb of upstream sequence was PCR amplified from genomic DNA with primers pDNR-110410-F (ACGAAGTTATCAGTCGAGGTACCGCTCAAACTATTCCTCCTCAATC) and pDNR-110410-R (ATGAGGGCCCCTAAGCTGTTTATTCTATATACAACAGTGATTAAATATACAATG) and cloned into SalI/HindIII-digested pDNR-EGFP by in-fusion cloning to give plasmid pDNR-TPM2/GFP. The 3'UTR of of this gene was amplified with primers pLP-110410-F (ATATGCTAGAGCGGCCATGTATGATATGTATTTTTTGCG) and pLP-110410-R (CACCGCGGTGGCGGCCAATTAAATGAAACTGCGGCAC) and the resulting fragment cloned into NotI-digested pLP-hDHFR by in-fusion cloning to give plasmid pLP-hDHFR/TPM2.
The tpm2-specific sequence from pDNR-TPM2/GFP was transferred to pLP-hDHFR/TPM2 by Cre/loxP recombination to give the final construct pLP-TPM2/GFP. This plasmid was digested with KpnI and SacII before gene targeting by double crossover homologous recombination. |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | |
Additional information primer 1 | |
Sequence Primer 2 | |
Additional information primer 2 | |
Sequence Primer 3 | |
Additional information primer 3 | |
Sequence Primer 4 | |
Additional information primer 4 | |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
|
top of page |