RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-4865

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_1104100; Gene model (P.falciparum): PF3D7_0504500; Gene product: MOLO1 domain-containing protein, putative (TPM2) Name tag: GFP
Phenotype	Fertilization and ookinete;

Last modified: 1 September 2020, 15:22

*RMgm-4865

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 32736136
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA 2.34
Other information parent line	P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/Researcher	Tremp AZ, Dessens JT
Name Group/Department	Department of Infection Biology, Faculty of Infectious and Tropical Diseases
Name Institute	London School of Hygiene & Tropical Medicine
City	London
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-4865
Principal name	TPM2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not tested
Gametocyte/Gamete	Not tested
Fertilization and ookinete	TMP2-GFP located in the crystalloid of ookinetes
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a C-terminal GFP-tagged version of TPM2 Protein (function) The protein TPM2 was identified in a GFP-affinity pulldown with high accuracy mass spectrometry using the GFP-tagged ookinete crystalloid protein LAP3 (PBANKA_0204500). This protein possesses a central TPM domain named after its founding proteins TLP18.3, Psb32 and MOLO-1 (Pfam 04536), as well as a transmembrane helix near its carboxy terminus. Phenotype TPM2-GFP located in the crystalloid of ookinetes Additional information Other mutants

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_1104100

Gene Model P. falciparum ortholog

PF3D7_0504500

Gene product

MOLO1 domain-containing protein, putative

Gene product: Alternative name

TPM2

top of page

Details of the genetic modification

Name of the tag

GFP

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

(Linear) plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

eef1a

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

The entire coding sequence of PBANKA_1104100 plus ca. 0.6 kb of upstream sequence was PCR amplified from genomic DNA with primers pDNR-110410-F (ACGAAGTTATCAGTCGAGGTACCGCTCAAACTATTCCTCCTCAATC) and pDNR-110410-R (ATGAGGGCCCCTAAGCTGTTTATTCTATATACAACAGTGATTAAATATACAATG) and cloned into SalI/HindIII-digested pDNR-EGFP by in-fusion cloning to give plasmid pDNR-TPM2/GFP. The 3'UTR of of this gene was amplified with primers pLP-110410-F (ATATGCTAGAGCGGCCATGTATGATATGTATTTTTTGCG) and pLP-110410-R (CACCGCGGTGGCGGCCAATTAAATGAAACTGCGGCAC) and the resulting fragment cloned into NotI-digested pLP-hDHFR by in-fusion cloning to give plasmid pLP-hDHFR/TPM2.
The tpm2-specific sequence from pDNR-TPM2/GFP was transferred to pLP-hDHFR/TPM2 by Cre/loxP recombination to give the final construct pLP-TPM2/GFP. This plasmid was digested with KpnI and SacII before gene targeting by double crossover homologous recombination.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page