Back to search resultsSummaryRMgm-4862
|
||||||||
*RMgm-4862| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 32736136 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Tremp AZ, Dessens JT |
| Name Group/Department | Department of Infection Biology, Faculty of Infectious and Tropical Diseases |
| Name Institute | London School of Hygiene & Tropical Medicine |
| City | London |
| Country | UK |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-4862 |
| Principal name | PHL1-GFP |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not tested |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | PHL1-GFP located in the crystalloid of ookinetes |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0417200 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0904200 | ||||||||||||||||||||||||||
| Gene product | PH domain-containing protein, putative | ||||||||||||||||||||||||||
| Gene product: Alternative name | PH, PH-like (PHL) domain-containing protein; PHL1 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | GFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | An approximately 1.5 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0417200 was PCR amplified from P. berghei genomic DNA with primers PH1-F (TTGGGCTGCAGTCGAGGTACCACAAAACAATTGTCATAAAATAGTTCTTG) and PH1-R (ATGAGGGCCCCTAAGCTCATATCGTTATCGTTTTCTTCATTG) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH1/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination. An approximately 1.8 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0704800 was PCR amplified from P. berghei genomic DNA with primers PH2-F (TTGGGCTGCAGTCGAGGTACCATGCGCATTTATAATATACATAAATAAG) and PH2-R (ATGAGGGCCCCTAAGCTCAAATTATCATCATCATTATCTTCATATTCTTC) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH2/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination. An approximately 2.0 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0704900 was PCR amplified from P. berghei genomic DNA with primers PH3-F (TTGGGCTGCAGTCGAGGTACCATTTCTTATTAATAGACAAAACAAAAATAAT) and PH3-R (ATGAGGGCCCCTAAGCTCTTAAGAGAAATATTTGGATTACTGCTTTT) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH3/GFP. The plasmid was linearized with NheI before gene targeting by single crossover homologous recombination. An approximately 1.8 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0902900 was PCR amplified from P. berghei genomic DNA with primers PH4-F (TTGGGCTGCAGTCGAGGTACCTTTGTACATACATTCAAAAGGCG) and PH4-R (ATGAGGGCCCCTAAGCTGGTCTCTGCTTTTATGGAAACTAAAAAA) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-PH4/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||