RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-4859
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1449300; Gene model (P.falciparum): PF3D7_1234700; Gene product: upregulated in late gametocytes ULG8 (CPW-WPC family protein; CPW2)
Name tag: GFP
Phenotype Fertilization and ookinete;
Last modified: 1 September 2020, 13:54
  *RMgm-4859
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 32736136
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherTremp AZ, Dessens JT
Name Group/DepartmentDepartment of Infection Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-4859
Principal nameCPW2-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNo discernible GFP signal in ookinetes
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of CPW2

Protein (function)
The protein CPW2 was identified in a GFP-affinity pulldown with high accuracy mass spectrometry using the GFP-tagged ookinete crystalloid protein LAP3 (PBANKA_0204500).
This protein is part of the nine-member ‘CPW-WPC’ domain-containing protein family

Phenotype
No discernible GFP signal in ookinetes

Additional information
From the paper:
Our analysis identified a further two proteins, namely PBANKA_1352500 and 1346300, which were previously reported to be crystalloid-resident by GFP tagging. These two proteins are part of the nine-member ‘CPW-WPC’ domain-containing protein family. Interestingly, an additional four members of this family were identified by our analysis of the LAP3 interactome, namely PBANKA_0943400, 1015400, 1449300 and 1218300. We generated GFP-tagged parasite lines for the latter four CPW-WPC proteins, which revealed that PBANKA_0943400 and 1015400, too, displayed weak GFP signal with a crystalloid-like distribution in ookinetes. Although we could not detect discernible GFP signal in ookinetes of the other two parasite lines, possibly due to low expression levels, our findings indicate that at least several CPW-WPC family members are involved with the crystalloid. 

Other mutants


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1449300
Gene Model P. falciparum ortholog PF3D7_1234700
Gene productupregulated in late gametocytes ULG8
Gene product: Alternative nameCPW-WPC family protein; CPW2
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAn approximately 2.2 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_0943400 was PCR amplified from P. berghei genomic DNA with primers CPW1-F (TTGGGCTGCAGTCGAGCAAGGGACTGTAATGGTGA) and CPW1-R (ATGAGGGCCCCTAAGCTCTCTAAGGTGATCCCTTTTTTGTTTG) and cloned into SalI/HindIII digested plasmid pBS-EGFP-hDHFR to give pBS-CPW1/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination.
An approximately 1.4 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1449300 was PCR amplified from P. berghei genomic DNA with primers CPW2-F (TTGGGCTGCAGTCGAGATAACAATTGAACTTGGTAAAGTAGCA) and CPW2-R (ATGAGGGCCCCTAAGCTCAATTTTTGAACTTGTATAAAAGAATAATTAATTT) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW2/GFP. The plasmid was linearized with HindIII before gene targeting by single crossover homologous recombination.
An approximately 2.4 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1218300 was PCR amplified from P. berghei genomic DNA with primers CPW3-F (TTGGGCTGCAGTCGAGCAATATGGGATTGCGATTTG) and CPW3-R (ATGAGGGCCCCTAAGCTCACATCGATTATTGCCCCTG) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW3/GFP. The plasmid was linearized with BlpI before gene targeting by single crossover homologous recombination. An approximately 1.5 kb fragment corresponding to the coding sequence and 5’UTR of PBANKA_1015400 was PCR amplified from P. berghei genomic DNA with primers CPW4-F2 (TTGGGCTGCAGTCGAGACAATTTTTTATTGTTAAAATAGATAATGG) and CPW4-R (ATGAGGGCCCCTAAGCTGATAACAAGGTTTGAAACTATTTCCCC) and cloned into SalI/HindIII-digested plasmid pBS-EGFP-hDHFR to give pBS-CPW4/GFP. The plasmid was linearized with ClaI before gene targeting by single crossover homologous recombination.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6