Back to search resultsSummaryRMgm-4856
|
||||||||
*RMgm-4856| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 32788672 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | Not applicable |
| Other information parent line | |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Akkaya M, Pierce SK |
| Name Group/Department | Laboratory of Immunogenetics, National Institute of Allergy and Infectious Diseases |
| Name Institute | National Institutes of Health |
| City | Rockville |
| Country | USA |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-4856 |
| Principal name | PbA-AP2(S) |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | PbANKA(S) induces ECM (like wild type PbANKA(F) parasites |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Protein (function) Evidence is presented that: From the Abstract: Other mutants
|
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0112100 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0613800 | ||||||||||||||||||||||||||
| Gene product | AP2 domain transcription factor, putative | ||||||||||||||||||||||||||
| Gene product: Alternative name | ApiAP2 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | A phenylalanine 1823 is replaced with with serine (F1823S) | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | CRISPR/Cas9 construct: integration through double strand break repair | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | For editing the AP2 (PBANKA_0112100) gene in Plasmodium berghei ANKA, replacing phenylalanine 1823 with serine (F1823S), we used the clustered regularly interspaced short palindromic repeat (CRISPR)-CRISPR-associated protein 9 (Cas9) system (CRISPR/Cas9). A single plasmid system containing pYC plasmid express all the essential components of CRISPR-Cas9; Cas9 endonuclease expressed as a fusion protein with drug selection marker hDHFR, gRNA:tracrRNA chimera driven by PyU6 promoter and a homology template for repair of double stranded break and concomitant introduction of desired mutation. A guide sequence of 20 nucleotides (5′ GCTGAATTAAAACCCCAAAG 3′), with protospacer adjacent motif (5′ AGG 3′), was selected by manual curation for targeting the Cas9 endonuclease to result in the desired editing (5,467 TTT to TCT) in the AP2 gene. The 900 nucleotides of synthetic sequence (given in Supplementary Information) containing the mutated guide region and the desired single nucleotide polymorphism (SNP) (5,467 TTT to TCT) and shield mutations to overcome repeated restriction of the modified genomic locus, was sub-cloned in the pYC plasmid using NcoI and XhoI restriction enzyme sites. The resulting plasmid, pYC_ANKAAP2NK65, was used for the transfection of the P. berghei ANKA parasites | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||