Back to search resultsSummaryRMgm-480
|
||||||||
*RMgm-480| Successful modification | The parasite was generated by the genetic modification | ||||||||||||||||||||||||
| The mutant contains the following genetic modification(s) | Gene disruption | ||||||||||||||||||||||||
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 21418605 | ||||||||||||||||||||||||
| MR4 number | |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Parent parasite used to introduce the genetic modification | |||||||||||||||||||||||||
| Rodent Malaria Parasite | P. berghei | ||||||||||||||||||||||||
| Parent strain/line | P. berghei ANKA | ||||||||||||||||||||||||
| Name parent line/clone | P. berghei ANKA cl15cy1 | ||||||||||||||||||||||||
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| The mutant parasite was generated by | |||||||||||||||||||||||||
| Name PI/Researcher | J. Fonager; S.M. Khan; C.J. Janse | ||||||||||||||||||||||||
| Name Group/Department | Leiden Malaria Research Group | ||||||||||||||||||||||||
| Name Institute | Leiden University Medical Center | ||||||||||||||||||||||||
| City | Leiden | ||||||||||||||||||||||||
| Country | The Netherlands | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Name of the mutant parasite | |||||||||||||||||||||||||
| RMgm number | RMgm-480 | ||||||||||||||||||||||||
| Principal name | 318cl1, 318cl2 | ||||||||||||||||||||||||
| Alternative name | Δp41 | ||||||||||||||||||||||||
| Standardized name | |||||||||||||||||||||||||
| Is the mutant parasite cloned after genetic modification | Yes | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Phenotype | |||||||||||||||||||||||||
| Asexual blood stage | The phenotype of blood stages has not been analysed in detail. During the cloning procedure no evidence has been found for a delayed/affected growth/multiplication of the asexual blood stages. The generation of mutants lacking expression of P41 indicates that P41 is not essential for asexual blood stage development. | ||||||||||||||||||||||||
| Gametocyte/Gamete | Not tested | ||||||||||||||||||||||||
| Fertilization and ookinete | Not tested | ||||||||||||||||||||||||
| Oocyst | Not tested | ||||||||||||||||||||||||
| Sporozoite | Not tested | ||||||||||||||||||||||||
| Liver stage | Not tested | ||||||||||||||||||||||||
| Additional remarks phenotype | Mutant/mutation Table: P. falciparum gene members of the 6-cys family
| ||||||||||||||||||||||||
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1002600 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0404900 | ||||||||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||||||||
| Gene product: Alternative name | P41 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GGGCCCCCCCTCGAGGTCGACGGTATCGATGTATTTGATTTATTAGTTGTGTGTCAAAAA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | ClaI, BamHI | ||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||