Summary

RMgm-4727
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1317200; Gene model (P.falciparum): PF3D7_1453500; Gene product: NAD(P) transhydrogenase, putative (NTH)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 10 February 2020, 13:04
  *RMgm-4727
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 31951090
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherSaeed S, Dessens JT
Name Group/DepartmentDepartment of Infection Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-4727
Principal nameNTH-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal fertilisation and normal numbers of ookinetes produced. However, pigment in these ookinetes was more dispersed and not found in clusters that typically surround and highlight the crystalloids.
OocystNormal numbers of ookinetes are produced. However, despite undergoing substantial nuclear expansion these oocysts failed to produce sporozoites.
SporozoiteNormal numbers of ookinetes are produced. However, despite undergoing substantial nuclear expansion these oocysts failed to produce sporozoites.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of NTH

Protein (function)
Genome analysis shows that Plasmodium species encode a single, conserved membrane-bound NAD(P) transhydrogenases (NTH).
Plasmodium berghei NTH is encoded by a three-exon gene and is composed of 1,201 amino acids with a calculated Mr of 135,198 and has a predicted amino-terminal ER signal peptide sequence that forms part of a bipartite apicoplast targeting sequence.  The gene product forms 11 predicted transmembrane helices and has additional domains for binding NAD(H) and NADP(H). This structure conforms with the general architecture of proton-translocating NTH proteins, consisting of three functional domains: domain I, which binds NAD(H); domain II, which contains the membrane-spanning helices, and domain III, which binds NADP(H). Functional domains I and III together facilitate hydride transfer between NAD(H) and NADP (H), whereas domain II facilitates proton translocation across the lipid bilayer in which the NTH protein is embedded. Whilst prokaryotes have segmented nth genes, eukaryotic nth genes are unsegmented and encode single polypeptide NTH proteins, either linking the a subunit C-terminus to the β subunit N-terminus (αβ) as illustrated by mammalian NTH or linking the b subunit C-terminus to the a subunit N-terminus (ba) as illustrated by Plasmodium NTH. Accordingly, the order of domains in Plasmodium NTH is dIIa-dIII-dI-dIIb.
NAD(P) transhydrogenases (NTHs) are enzymes that catalyse the reversible hydride ion transfer between NAD(H) and NADP(H). They exist as soluble (EC 1.6.1.1) and membrane-bound (EC 1.6.1.2) isoforms. The latter are integral multi-pass membrane proteins that in bacteria reside in the cytoplasmic membrane, whilst in metazoans they are situated in the inner membrane of mitochondria, likely reflecting the evolutionary origin of the mitochondrion from a bacterial primary endosymbiont The widely accepted view of the physiological role of mitochondrial NTH is to generate NADPH (the reduced form of NADP), either required for mitochondrion-specific biosynthetic purposes, or to protect the organelle from oxidative damage caused by free radicals generated in the respiratory chain.
In this study, we characterise a membrane-bound NTH in malaria parasites that is not present in mitochondria, but instead localises in the crystalloid, an enigmatic organelle found in ookinetes and young oocysts that is critically involved in sporogony. We show that NTH has an essential structural role in crystalloid formation, as well as a vital enzymatic role in sporogony, indicating that the organelle requires NADPH to function. NTH is also found in the sporozoite apicoplast, addressing a longstanding question about the potential source of NADPH required for some of the anabolic activities that take place in this plastid of likely red algal origin.

Phenotype
Normal fertilisation and normal numbers of ookinetes produced. However, pigment in these ookinetes was more dispersed and not found in clusters that typically surround and highlight the crystalloids.
Normal numbers of ookinetes are produced. However, despite undergoing substantial nuclear expansion these oocysts failed to produce sporozoites.
These collective findings demonstrate that NTH is required for crystalloid biogenesis and sporozoite development.

Additional information
Various Plasmodium transcriptome studies identified transcripts of the nth gene predominantly in female gametocytes and to be translationally repressed. To determine NTH protein expression and subcellular localisation, a genetically modified parasite was generated by double homologous crossover recombination that stably expresses, from its native promoter, the full length NTH fused at its carboxy-terminus to GFP (RMgm-4728). The resulting parasites (termed NTH/GFP) developed normally in mouse and mosquito and were transmitted by mosquito bite, indicating that the GFP tag had not interfered with NTH function. In the mouse, neither asexual nor sexual blood-stage parasites displayed discernible GFP-based fluorescence. Dispersed extranuclear GFP fluorescence was first detected in zygotes ~ 4 h after gametocyte activation consistent with a post-fertilisation lifting of translational repression and a localisation of the protein in the ER. By 24 h, mature ookinetes showed GFP fluorescence that was concentrated in typically two spots associated with pigment clusters. This distribution pattern is  characteristic of proteins that are trafficked to the crystalloids. Previous studies have shown that a protein complex of six modular proteins rich in putative carbohydrate binding domains, named LCCL lectin adhesive-like proteins (LAPs), resides in the crystalloid. To confirm the localisation of NTH in the crystalloid, we co-localised NTH with LAP3. To achieve this, a parasite line expressing mCherry-tagged LAP3 (named LAP3/mCherry; see RMgm-1473)) was genetically crossed in vitro with parasite line NTH/GFP. Subsequent infection of mosquitoes with the resultant ookinete population gives rise to heterokaryotic polyploid oocysts containing mixtures of parental, wild-type, and double gene-tagged (i.e. possessing modified alleles for both nth and lap3) sporozoites. The ensuing sporozoite population was transmitted to naive mice by mosquito bite and drug selected. Ookinete cultures derived from the transmitted parasite population contained zygotes and ookinetes with dual expression of NTH::GFP and LAP3::mCherry that co-localised both before and after crystalloid formation, respectively.

Apart from very young oocysts that still possess crystalloids, no discernible GFP fluorescence was observed in oocysts before sporulation. However, GFP fluorescence was observed in sporulated oocysts and in individual sporozoites, indicating that NTH is once again expressed in sporozoites. Sporozoite NTH was concentrated in a tubular structure reminiscent of the apicoplast, consistent with NTH possessing a predicted apicoplast transit peptide (see further RMgm-4728)

A different parasite line named NTHΔPP was generated (RMgm-4729) that expresses an N-terminally truncated version of NTH::GFP in which 60 amino acids were removed downstream of the ER signal peptide, including the predicted apicoplast transit peptide. NTHΔPP ookinetes displayed weak dispersed GFP fluorescence that did not localise in crystalloids, and typical crystalloid-associated pigment clusters were absent, as was observed in NTH-KO ookinetes. NTHΔPP parasites formed normal numbers of oocysts in mosquitoes, but like NTH-KO parasites these failed to produce sporozoites. These collective findings indicate that the truncated NTH protein expressed in NTHΔPP parasites is structurally compromised and dysfunctional, resulting in a loss-of-function phenotype.

We created a parasite line expressing a structurally intact, but enzymatically inactive version of NTH (RMgm-4730). To do so, the highly conserved aspartic acid residue at position 500 was mutated to a lysine. The equivalent point mutation in bacterial NTH abolishes both hydride transfer and proton-translocating activities. Ookinetes of the resulting NTH functional knockout (named NTH/ND500LK) displayed GFP fluorescence in discrete spots that co-localised with pigment clusters, indicative of normal crystalloid formation. This shows that NTH needs to be physically present and structurally intact, but not enzymatically active, to facilitate crystalloid biogenesis. Like NTH structural knockout parasites, NTH/ND500LK parasites developed oocysts, confirming that NTH activity is not required for oocyst development per se. Like the previous NTH mutants, NTH/ND500LK oocysts reached a larger size and failed to sporulate, showing that NTH activity is essential for sporogony.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1317200
Gene Model P. falciparum ortholog PF3D7_1453500
Gene productNAD(P) transhydrogenase, putative
Gene product: Alternative nameNTH
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo generate a construct for nth gene knockout, pBS-NTH3/GFP was PCR amplified with primers NTH-KO-R (CTAAGCTCCTACAATGGTTATGTCCAATCAGATG) and NTH-KO-F (ATTGTAGGAGCTTAGGGGCCCTCAT), and the PCR product was circularised by in-fusion to give pBS-NTH-KO. This removes the entire nth sequence except for the first 21 codons, in frame with the gfp module, to generate parasite line NTH-KO. To generate a construct removing residues 25–83 from the nth coding region, pBS-NTH3/GFP was PCR amplified with primers NTHdeltaPP-F (TTAAATCTCGAGGCTCCGTCTTATTCGTTCATACC) and NTHdeltaPP-R (CTCGAGATTTAATCTACAATGGTTATGTCCAATC), and the product was circularised by in-fusion to give pBSNTH4/GFP. This introduces a diagnostic XhoI restriction site at the site of the deletion. This plasmid was used to generate parasite line NTHDPP. To generate a construct containing an enzymatically inactive nth coding region, pBS-NTH3/GFP was PCR amplified with primers NTH-ND500LK-F (AGCGCTTAAAATTATCAATCCATCTTCCTTAGATCC) and NTH-ND500LK-R (ATAATTTTAAGCGCTCCAACAACTAAAACTAAATCAAC), and the product was circularised by infusion to give pBS-NTH5/GFP. This introduces a diagnostic AfeI restriction site at the site of the point mutation. This plasmid was used to generate parasite line NTH/ND500LK.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6