Mutant/mutation

A transposase mediated piggyBac insertion into the open reading frame (ORF).

PiggyBac insertion into the TTAA tetranucleotide insertion site

TCTATTACTTGTACCATCAATTAATAACTCTATTAGCTCTTCAC

The piggyBac insert was identified using a TAIL PCR approach. The piggyBac insertion is expected to affect/disrupt expression of the gene. The presence of an insert in the ORF may therefore provide indirect evidence that the gene is NOT essential for blood stage development. However, neither expression or the phenotype of the mutant containing the insert have been analysed.

PiggyBac-mediated insertion was achieved when parasites containing the transposase gene stably integrated into the genome (see RMgm-406) were transfected with piggyBac donor plasmids.

In the paper describing this mutant two different approaches were used to obtain insertion of piggyBac elements into the genome of P. berghei.
In the first approach parasites were ‘co-transfected’ with both piggyBac donor plasmid (pL1302) and the helper plasmid (pL1301). The helper plasmid contains the transposase under the control of the constitutive eef1a promoter and this plasmid does not contain a drug-selection cassette (see Figure). Since plasmids are not retained in parasites during asexual growth without drug-selection the helper plasmid is ‘transiently transfected’ and will be lost from the parasites during blood stage growth.
In the second approach the donor plasmid was transfected into transgenic parasites that contained the transposase gene stably integrated into the c/d-ssu-rrna gene locus.  This transgenic line, TPSama1 (RMgm-406), was generated using standard methods for transfection of P. berghei and the transgenic parasites contain the T. gondii dhfr/ts as a selectable marker and transposase under the control of the schizont specific ama-1 promoter (see Figure).
The donor plasmid contains the 5’and 3’ inverted terminal repeats of the piggyBac element which are the minimal cis elements necessary for piggyBac mobilization. Both inverted repeat sequences consist of a terminal 13 bp and internal 19 bp perfect inverted repeat that are separated by a 3 bp (5′ITR) or a 31 bp (3′ITR) spacer. In the donor plasmid the two ITR sequences are located on both sides of a drug-selectable marker cassette and a gfp expression cassette that lacks a promoter region (see Figure). The target site for piggyBac insertion is TTAA and it moves by precise insertion and excision mechanisms. Transfection of the donor plasmid would therefore result in insertion of both the drug-selectable marker cassette and the gfp-expression site without leaving a footprint at an insertion site. Insertion of the drug selectable marker, the human dhfr gene, allows for selection of parasites containing the inserts using pyrimethamine or WR99210.